Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634183_at:

>probe:Drosophila_2:1634183_at:284:617; Interrogation_Position=2009; Antisense; TGCACATACGCACGCATACGGGTGA
>probe:Drosophila_2:1634183_at:16:719; Interrogation_Position=2041; Antisense; TTCGCATGTTCGCTTTGTGGCAAGA
>probe:Drosophila_2:1634183_at:622:275; Interrogation_Position=2053; Antisense; CTTTGTGGCAAGAGCTTTCGGCAGA
>probe:Drosophila_2:1634183_at:374:715; Interrogation_Position=2069; Antisense; TTCGGCAGAAGGCTCATCTGGCCAA
>probe:Drosophila_2:1634183_at:609:547; Interrogation_Position=2143; Antisense; GGAGGATCCGGCAAACATCAACGAT
>probe:Drosophila_2:1634183_at:372:271; Interrogation_Position=2246; Antisense; CTTCGTTGCCCGTGATGATCAGCAA
>probe:Drosophila_2:1634183_at:378:443; Interrogation_Position=2259; Antisense; GATGATCAGCAATCCCAATACGCCA
>probe:Drosophila_2:1634183_at:536:241; Interrogation_Position=2275; Antisense; AATACGCCACCTGGAGGAGTGCTGC
>probe:Drosophila_2:1634183_at:689:227; Interrogation_Position=2308; Antisense; AATGGACTCCTTGCCAATCGATGCG
>probe:Drosophila_2:1634183_at:76:419; Interrogation_Position=2360; Antisense; GAGCTGAGTGCACACGAAAGCGCAT
>probe:Drosophila_2:1634183_at:368:353; Interrogation_Position=2385; Antisense; GCAGCTGCGCATGTCAACAACGGAT
>probe:Drosophila_2:1634183_at:133:115; Interrogation_Position=2477; Antisense; AGCAGCAGGCGCATCAACAGGCAGG
>probe:Drosophila_2:1634183_at:294:349; Interrogation_Position=2497; Antisense; GCAGGCGGCACTTGTCAGTCAAAAT
>probe:Drosophila_2:1634183_at:686:339; Interrogation_Position=2564; Antisense; GCTACAAATGCGTGCCATCAGCGTA

Paste this into a BLAST search page for me
TGCACATACGCACGCATACGGGTGATTCGCATGTTCGCTTTGTGGCAAGACTTTGTGGCAAGAGCTTTCGGCAGATTCGGCAGAAGGCTCATCTGGCCAAGGAGGATCCGGCAAACATCAACGATCTTCGTTGCCCGTGATGATCAGCAAGATGATCAGCAATCCCAATACGCCAAATACGCCACCTGGAGGAGTGCTGCAATGGACTCCTTGCCAATCGATGCGGAGCTGAGTGCACACGAAAGCGCATGCAGCTGCGCATGTCAACAACGGATAGCAGCAGGCGCATCAACAGGCAGGGCAGGCGGCACTTGTCAGTCAAAATGCTACAAATGCGTGCCATCAGCGTA

Full Affymetrix probeset data:

Annotations for 1634183_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime