FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634185_at:

>probe:Drosophila_2:1634185_at:395:489; Interrogation_Position=1006; Antisense; GTACGGCGATAGTTCTGGTCCATAT
>probe:Drosophila_2:1634185_at:150:63; Interrogation_Position=1029; Antisense; ATGTGCTATTTGGTTTCCTGCGACT
>probe:Drosophila_2:1634185_at:581:285; Interrogation_Position=1115; Antisense; CTGGGACTGGTCATTTCGGGATGCC
>probe:Drosophila_2:1634185_at:467:95; Interrogation_Position=1160; Antisense; AGATTCGCGGGAAGCCATCCACTAA
>probe:Drosophila_2:1634185_at:255:297; Interrogation_Position=1178; Antisense; CCACTAACATTCTCGGGCAATCGGA
>probe:Drosophila_2:1634185_at:443:281; Interrogation_Position=1214; Antisense; CTGCTGCTCATCTACCAATTATTTG
>probe:Drosophila_2:1634185_at:313:345; Interrogation_Position=1308; Antisense; GCATTGCAATCACCTATATTCTGGA
>probe:Drosophila_2:1634185_at:540:281; Interrogation_Position=1352; Antisense; CTCCGCCAAATGGATTTCGCAGCAA
>probe:Drosophila_2:1634185_at:437:143; Interrogation_Position=1402; Antisense; ACTGTACTTCTTTATCCTGGGAGGC
>probe:Drosophila_2:1634185_at:241:691; Interrogation_Position=1433; Antisense; TTAGCAGGATTTCTCTTCAGTGTTT
>probe:Drosophila_2:1634185_at:229:711; Interrogation_Position=1448; Antisense; TTCAGTGTTTGGTACATGCCCGAAA
>probe:Drosophila_2:1634185_at:377:565; Interrogation_Position=1513; Antisense; GGAATTCGTAATTCCACCAGCCTGA
>probe:Drosophila_2:1634185_at:709:523; Interrogation_Position=939; Antisense; GGGCTTTATACGCTCTCAGCTTGAG
>probe:Drosophila_2:1634185_at:198:117; Interrogation_Position=956; Antisense; AGCTTGAGCGTGATGGTGGCCTTCA

Paste this into a BLAST search page for me
GTACGGCGATAGTTCTGGTCCATATATGTGCTATTTGGTTTCCTGCGACTCTGGGACTGGTCATTTCGGGATGCCAGATTCGCGGGAAGCCATCCACTAACCACTAACATTCTCGGGCAATCGGACTGCTGCTCATCTACCAATTATTTGGCATTGCAATCACCTATATTCTGGACTCCGCCAAATGGATTTCGCAGCAAACTGTACTTCTTTATCCTGGGAGGCTTAGCAGGATTTCTCTTCAGTGTTTTTCAGTGTTTGGTACATGCCCGAAAGGAATTCGTAATTCCACCAGCCTGAGGGCTTTATACGCTCTCAGCTTGAGAGCTTGAGCGTGATGGTGGCCTTCA

Full Affymetrix probeset data:

Annotations for 1634185_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720