FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634189_at:

>probe:Drosophila_2:1634189_at:347:651; Interrogation_Position=1763; Antisense; TCACATATCTCACATGGCTACCATA
>probe:Drosophila_2:1634189_at:712:697; Interrogation_Position=1835; Antisense; TTTAGCTTTGTGAATCTCGTTCGCA
>probe:Drosophila_2:1634189_at:113:639; Interrogation_Position=1851; Antisense; TCGTTCGCACTTGAACATCTTCCAA
>probe:Drosophila_2:1634189_at:311:193; Interrogation_Position=1874; Antisense; AACTAACTCTGCCTTAGCACAAAGT
>probe:Drosophila_2:1634189_at:568:19; Interrogation_Position=1915; Antisense; ATTTGATAAGCTAATTTCGCCCTGC
>probe:Drosophila_2:1634189_at:353:321; Interrogation_Position=1933; Antisense; GCCCTGCTTTTACCCATGAATTTAT
>probe:Drosophila_2:1634189_at:147:275; Interrogation_Position=1965; Antisense; CATTGTTTCAATTATTAGCTGCTAC
>probe:Drosophila_2:1634189_at:415:483; Interrogation_Position=2049; Antisense; GTATGCACTTCGATATTTCGAGAGC
>probe:Drosophila_2:1634189_at:52:377; Interrogation_Position=2102; Antisense; GAAGAATCTCACAACGAACTACGGA
>probe:Drosophila_2:1634189_at:543:201; Interrogation_Position=2128; Antisense; AACCCGTTTCAATTGCATTCTGAGC
>probe:Drosophila_2:1634189_at:177:29; Interrogation_Position=2227; Antisense; ATACGGAATAAGTTGGCGTCCATTT
>probe:Drosophila_2:1634189_at:694:577; Interrogation_Position=2240; Antisense; TGGCGTCCATTTTTGCTTAACTAAA
>probe:Drosophila_2:1634189_at:47:617; Interrogation_Position=2289; Antisense; TGAATTGTGTGCATACCGTCTCACC
>probe:Drosophila_2:1634189_at:683:131; Interrogation_Position=2303; Antisense; ACCGTCTCACCACGCAAATGATTTT

Paste this into a BLAST search page for me
TCACATATCTCACATGGCTACCATATTTAGCTTTGTGAATCTCGTTCGCATCGTTCGCACTTGAACATCTTCCAAAACTAACTCTGCCTTAGCACAAAGTATTTGATAAGCTAATTTCGCCCTGCGCCCTGCTTTTACCCATGAATTTATCATTGTTTCAATTATTAGCTGCTACGTATGCACTTCGATATTTCGAGAGCGAAGAATCTCACAACGAACTACGGAAACCCGTTTCAATTGCATTCTGAGCATACGGAATAAGTTGGCGTCCATTTTGGCGTCCATTTTTGCTTAACTAAATGAATTGTGTGCATACCGTCTCACCACCGTCTCACCACGCAAATGATTTT

Full Affymetrix probeset data:

Annotations for 1634189_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720