Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634191_at:

>probe:Drosophila_2:1634191_at:408:349; Interrogation_Position=1309; Antisense; GCAGATCTACCCAGGACCTTACTAT
>probe:Drosophila_2:1634191_at:548:75; Interrogation_Position=1321; Antisense; AGGACCTTACTATCATGGCTCGCAG
>probe:Drosophila_2:1634191_at:233:35; Interrogation_Position=1332; Antisense; ATCATGGCTCGCAGTACGGACCCTA
>probe:Drosophila_2:1634191_at:93:381; Interrogation_Position=1345; Antisense; GTACGGACCCTACAACTACTAGAGG
>probe:Drosophila_2:1634191_at:331:191; Interrogation_Position=1358; Antisense; AACTACTAGAGGCACACCCGAAGGG
>probe:Drosophila_2:1634191_at:695:261; Interrogation_Position=1395; Antisense; CAGCCAGCAGCTGCAATTGAGTTAT
>probe:Drosophila_2:1634191_at:121:675; Interrogation_Position=1462; Antisense; TAGCCCTCCCCAGTAATCAAAATAG
>probe:Drosophila_2:1634191_at:632:421; Interrogation_Position=1486; Antisense; GAGCAAGCGCTAACGAAATCTTAAA
>probe:Drosophila_2:1634191_at:108:31; Interrogation_Position=1626; Antisense; ATAACTGATCGTGGGACTTGAGTCA
>probe:Drosophila_2:1634191_at:712:719; Interrogation_Position=1643; Antisense; TTGAGTCAAAGTTGCGTCCAAGTTT
>probe:Drosophila_2:1634191_at:507:327; Interrogation_Position=1656; Antisense; GCGTCCAAGTTTTTGGTGCGCGAAT
>probe:Drosophila_2:1634191_at:658:477; Interrogation_Position=1730; Antisense; GTTTTATATGTTGACCACGGCGAGA
>probe:Drosophila_2:1634191_at:466:413; Interrogation_Position=1742; Antisense; GACCACGGCGAGATGGCGATTTAAA
>probe:Drosophila_2:1634191_at:259:111; Interrogation_Position=1796; Antisense; AGCACGTAACGTACATGTAGCGTAT

Paste this into a BLAST search page for me
GCAGATCTACCCAGGACCTTACTATAGGACCTTACTATCATGGCTCGCAGATCATGGCTCGCAGTACGGACCCTAGTACGGACCCTACAACTACTAGAGGAACTACTAGAGGCACACCCGAAGGGCAGCCAGCAGCTGCAATTGAGTTATTAGCCCTCCCCAGTAATCAAAATAGGAGCAAGCGCTAACGAAATCTTAAAATAACTGATCGTGGGACTTGAGTCATTGAGTCAAAGTTGCGTCCAAGTTTGCGTCCAAGTTTTTGGTGCGCGAATGTTTTATATGTTGACCACGGCGAGAGACCACGGCGAGATGGCGATTTAAAAGCACGTAACGTACATGTAGCGTAT

Full Affymetrix probeset data:

Annotations for 1634191_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime