FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634192_at:

>probe:Drosophila_2:1634192_at:612:415; Interrogation_Position=465; Antisense; GAGCCTTACGAGCTGTTTGTCTATA
>probe:Drosophila_2:1634192_at:460:335; Interrogation_Position=519; Antisense; GCTCGATACGAGGATTTTGCCATTG
>probe:Drosophila_2:1634192_at:453:315; Interrogation_Position=537; Antisense; GCCATTGGGAATGCATCAGCGTCCT
>probe:Drosophila_2:1634192_at:298:307; Interrogation_Position=559; Antisense; CCTATGCGCTATCTGTTTTGGGTAA
>probe:Drosophila_2:1634192_at:444:241; Interrogation_Position=583; Antisense; AATACTCGGGAGACGCCGGTGATTC
>probe:Drosophila_2:1634192_at:660:275; Interrogation_Position=632; Antisense; CTTCTCCACATTCGATCACGATGAT
>probe:Drosophila_2:1634192_at:547:55; Interrogation_Position=652; Antisense; ATGATACGGGTCACGGATGCGCCAG
>probe:Drosophila_2:1634192_at:634:73; Interrogation_Position=714; Antisense; AGGAGCAACCTCAATGGCCAATATT
>probe:Drosophila_2:1634192_at:379:597; Interrogation_Position=766; Antisense; TGTCGGGTCGTGGAATCACCTGGAT
>probe:Drosophila_2:1634192_at:238:443; Interrogation_Position=788; Antisense; GATGAGCTGGCGTGGCTACGACTAC
>probe:Drosophila_2:1634192_at:11:445; Interrogation_Position=833; Antisense; GATGATCAGACCCAAGTGTTCCAAC
>probe:Drosophila_2:1634192_at:286:83; Interrogation_Position=847; Antisense; AGTGTTCCAACAACCTACGAAGGCA
>probe:Drosophila_2:1634192_at:195:605; Interrogation_Position=985; Antisense; TGATAATAACCGTTTCCCGCTGATT
>probe:Drosophila_2:1634192_at:602:479; Interrogation_Position=996; Antisense; GTTTCCCGCTGATTTGTTTGTTGTA

Paste this into a BLAST search page for me
GAGCCTTACGAGCTGTTTGTCTATAGCTCGATACGAGGATTTTGCCATTGGCCATTGGGAATGCATCAGCGTCCTCCTATGCGCTATCTGTTTTGGGTAAAATACTCGGGAGACGCCGGTGATTCCTTCTCCACATTCGATCACGATGATATGATACGGGTCACGGATGCGCCAGAGGAGCAACCTCAATGGCCAATATTTGTCGGGTCGTGGAATCACCTGGATGATGAGCTGGCGTGGCTACGACTACGATGATCAGACCCAAGTGTTCCAACAGTGTTCCAACAACCTACGAAGGCATGATAATAACCGTTTCCCGCTGATTGTTTCCCGCTGATTTGTTTGTTGTA

Full Affymetrix probeset data:

Annotations for 1634192_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720