Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634193_at:

>probe:Drosophila_2:1634193_at:510:669; Interrogation_Position=239; Antisense; TACTGCGTCGCAATTTCGAAGTTGT
>probe:Drosophila_2:1634193_at:642:197; Interrogation_Position=289; Antisense; AACGTCACGGATCGAATGGTGGCCA
>probe:Drosophila_2:1634193_at:595:521; Interrogation_Position=307; Antisense; GTGGCCACGGCGATCTTCGGAAGAC
>probe:Drosophila_2:1634193_at:272:103; Interrogation_Position=328; Antisense; AGACCACTCTTCACCAATGATAGCA
>probe:Drosophila_2:1634193_at:61:231; Interrogation_Position=343; Antisense; AATGATAGCATGCTGCCCTTCATAG
>probe:Drosophila_2:1634193_at:532:281; Interrogation_Position=355; Antisense; CTGCCCTTCATAGATGTTACTCCAA
>probe:Drosophila_2:1634193_at:715:253; Interrogation_Position=397; Antisense; CAACGTGCTCCTCGCAAAACGAAAT
>probe:Drosophila_2:1634193_at:164:633; Interrogation_Position=487; Antisense; TCCGTAACCCACATGCTGAAGCAAA
>probe:Drosophila_2:1634193_at:112:415; Interrogation_Position=541; Antisense; GAGCCGATTCCGTACTTTAAACTGA
>probe:Drosophila_2:1634193_at:296:473; Interrogation_Position=595; Antisense; GTTCAGAACGCTTTGCAACTGTCGT
>probe:Drosophila_2:1634193_at:1:361; Interrogation_Position=609; Antisense; GCAACTGTCGTTTCTTGTCAAGGAG
>probe:Drosophila_2:1634193_at:130:695; Interrogation_Position=666; Antisense; TTTGCCATTGGTTCGCGTTGTGAAT
>probe:Drosophila_2:1634193_at:210:269; Interrogation_Position=721; Antisense; CAGGCTATTTGTTCCATCGATGTTA
>probe:Drosophila_2:1634193_at:557:111; Interrogation_Position=767; Antisense; AGCACTACAACCTACATGAGCCAAT

Paste this into a BLAST search page for me
TACTGCGTCGCAATTTCGAAGTTGTAACGTCACGGATCGAATGGTGGCCAGTGGCCACGGCGATCTTCGGAAGACAGACCACTCTTCACCAATGATAGCAAATGATAGCATGCTGCCCTTCATAGCTGCCCTTCATAGATGTTACTCCAACAACGTGCTCCTCGCAAAACGAAATTCCGTAACCCACATGCTGAAGCAAAGAGCCGATTCCGTACTTTAAACTGAGTTCAGAACGCTTTGCAACTGTCGTGCAACTGTCGTTTCTTGTCAAGGAGTTTGCCATTGGTTCGCGTTGTGAATCAGGCTATTTGTTCCATCGATGTTAAGCACTACAACCTACATGAGCCAAT

Full Affymetrix probeset data:

Annotations for 1634193_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime