FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634194_at:

>probe:Drosophila_2:1634194_at:722:181; Interrogation_Position=249; Antisense; AAAACGCTCAAAATGCGCGGCCAGG
>probe:Drosophila_2:1634194_at:98:299; Interrogation_Position=264; Antisense; CGCGGCCAGGCATTTGTGATCTTCA
>probe:Drosophila_2:1634194_at:602:75; Interrogation_Position=289; Antisense; AGGAGATCGGCAGCGCTTCGAATGC
>probe:Drosophila_2:1634194_at:586:485; Interrogation_Position=406; Antisense; GTACCTTCAAGGAGCGCCCCAAGAA
>probe:Drosophila_2:1634194_at:626:201; Interrogation_Position=445; Antisense; AACCAGCGCCGGGTACCGATGAGAA
>probe:Drosophila_2:1634194_at:502:237; Interrogation_Position=561; Antisense; AATCTGCCCGAGGAGACCAACGAGA
>probe:Drosophila_2:1634194_at:428:51; Interrogation_Position=588; Antisense; ATGCTGTCCATGCTGTTCAATCAGT
>probe:Drosophila_2:1634194_at:627:291; Interrogation_Position=608; Antisense; TCAGTTCCCCGGCTTCAAGGAGGTG
>probe:Drosophila_2:1634194_at:412:79; Interrogation_Position=628; Antisense; AGGTGCGTCTTGTGCCGAATCGTCA
>probe:Drosophila_2:1634194_at:188:237; Interrogation_Position=645; Antisense; AATCGTCACGACATCGCCTTTGTGG
>probe:Drosophila_2:1634194_at:415:473; Interrogation_Position=671; Antisense; GTTCACCACCGAGTTGCAGAGCAAT
>probe:Drosophila_2:1634194_at:322:79; Interrogation_Position=715; Antisense; AGGGCTTCAAGATTACGCCGACGCA
>probe:Drosophila_2:1634194_at:158:319; Interrogation_Position=731; Antisense; GCCGACGCACGCCATGAAGATAACG
>probe:Drosophila_2:1634194_at:679:109; Interrogation_Position=763; Antisense; AGAAGTGAACGCAACTCCAGTCGCC

Paste this into a BLAST search page for me
AAAACGCTCAAAATGCGCGGCCAGGCGCGGCCAGGCATTTGTGATCTTCAAGGAGATCGGCAGCGCTTCGAATGCGTACCTTCAAGGAGCGCCCCAAGAAAACCAGCGCCGGGTACCGATGAGAAAATCTGCCCGAGGAGACCAACGAGAATGCTGTCCATGCTGTTCAATCAGTTCAGTTCCCCGGCTTCAAGGAGGTGAGGTGCGTCTTGTGCCGAATCGTCAAATCGTCACGACATCGCCTTTGTGGGTTCACCACCGAGTTGCAGAGCAATAGGGCTTCAAGATTACGCCGACGCAGCCGACGCACGCCATGAAGATAACGAGAAGTGAACGCAACTCCAGTCGCC

Full Affymetrix probeset data:

Annotations for 1634194_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720