FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634195_at:

>probe:Drosophila_2:1634195_at:471:155; Interrogation_Position=2021; Antisense; ACAGACACTGAGGACCAACTAGAGT
>probe:Drosophila_2:1634195_at:531:253; Interrogation_Position=2036; Antisense; CAACTAGAGTTAAGTGTCGGCCGGT
>probe:Drosophila_2:1634195_at:571:509; Interrogation_Position=2049; Antisense; GTGTCGGCCGGTACTCAACTGAGAA
>probe:Drosophila_2:1634195_at:356:217; Interrogation_Position=2077; Antisense; AAGTCATTCCTTATCATTTTTCCAA
>probe:Drosophila_2:1634195_at:598:501; Interrogation_Position=2146; Antisense; GTCGAGCGGCGATAATGAAACTAAC
>probe:Drosophila_2:1634195_at:531:291; Interrogation_Position=2253; Antisense; CGATGTCTTTCCAAGCGAACGGTAT
>probe:Drosophila_2:1634195_at:116:45; Interrogation_Position=2297; Antisense; ATCGCTTATAAAGGGCTTAGCTGCT
>probe:Drosophila_2:1634195_at:444:15; Interrogation_Position=2327; Antisense; ATTATCATCCAGCTTGCAAATTCAG
>probe:Drosophila_2:1634195_at:474:345; Interrogation_Position=2354; Antisense; GCATGTTGCCTTCCCTGTATTTTTA
>probe:Drosophila_2:1634195_at:253:165; Interrogation_Position=2379; Antisense; AAATCACAATTGCACTCTCTTCGTC
>probe:Drosophila_2:1634195_at:255:717; Interrogation_Position=2398; Antisense; TTCGTCCGCAACAAGCTCAGCAGGT
>probe:Drosophila_2:1634195_at:586:205; Interrogation_Position=2410; Antisense; AAGCTCAGCAGGTGGTATCCCTGAC
>probe:Drosophila_2:1634195_at:97:261; Interrogation_Position=2435; Antisense; CACCAACTCTGTGGCGGAGTCCAAT
>probe:Drosophila_2:1634195_at:4:519; Interrogation_Position=2462; Antisense; GTGGAGTTATCCAGTCGGCAACATT

Paste this into a BLAST search page for me
ACAGACACTGAGGACCAACTAGAGTCAACTAGAGTTAAGTGTCGGCCGGTGTGTCGGCCGGTACTCAACTGAGAAAAGTCATTCCTTATCATTTTTCCAAGTCGAGCGGCGATAATGAAACTAACCGATGTCTTTCCAAGCGAACGGTATATCGCTTATAAAGGGCTTAGCTGCTATTATCATCCAGCTTGCAAATTCAGGCATGTTGCCTTCCCTGTATTTTTAAAATCACAATTGCACTCTCTTCGTCTTCGTCCGCAACAAGCTCAGCAGGTAAGCTCAGCAGGTGGTATCCCTGACCACCAACTCTGTGGCGGAGTCCAATGTGGAGTTATCCAGTCGGCAACATT

Full Affymetrix probeset data:

Annotations for 1634195_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720