FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634196_at:

>probe:Drosophila_2:1634196_at:674:359; Interrogation_Position=1101; Antisense; GCAAGTCAGCCAATGCCAATTGAAG
>probe:Drosophila_2:1634196_at:265:729; Interrogation_Position=1194; Antisense; TTGGAACCGCAACCAGACGATCTTG
>probe:Drosophila_2:1634196_at:542:103; Interrogation_Position=1208; Antisense; AGACGATCTTGATGTGCCTGCTGAA
>probe:Drosophila_2:1634196_at:382:317; Interrogation_Position=1223; Antisense; GCCTGCTGAAGTTGCCTTGATTGAT
>probe:Drosophila_2:1634196_at:50:123; Interrogation_Position=676; Antisense; AGCGTGCTCTTTTCTCTGAGAATTC
>probe:Drosophila_2:1634196_at:11:551; Interrogation_Position=716; Antisense; GGAGCAGATGCAACTAGCTGTCGAA
>probe:Drosophila_2:1634196_at:129:529; Interrogation_Position=770; Antisense; GGTGGCCGCTTTGACTCACAAAAGA
>probe:Drosophila_2:1634196_at:162:459; Interrogation_Position=793; Antisense; GATATATACCCACCCACAAGGAATG
>probe:Drosophila_2:1634196_at:183:421; Interrogation_Position=822; Antisense; GAGCAGCGTCGTCTTAAAGCCGAAA
>probe:Drosophila_2:1634196_at:219:389; Interrogation_Position=843; Antisense; GAAAACTCGCAAACCACAGTGGACC
>probe:Drosophila_2:1634196_at:3:155; Interrogation_Position=858; Antisense; ACAGTGGACCAGATGACTCCGGCCA
>probe:Drosophila_2:1634196_at:440:183; Interrogation_Position=897; Antisense; AAAAGATACATACCCACCACCAAGG
>probe:Drosophila_2:1634196_at:177:313; Interrogation_Position=935; Antisense; GCGTCGTTTCAAGCTTAAGGCCAAG
>probe:Drosophila_2:1634196_at:708:171; Interrogation_Position=971; Antisense; AAAGAACGCCACTTCGGCCAATTCA

Paste this into a BLAST search page for me
GCAAGTCAGCCAATGCCAATTGAAGTTGGAACCGCAACCAGACGATCTTGAGACGATCTTGATGTGCCTGCTGAAGCCTGCTGAAGTTGCCTTGATTGATAGCGTGCTCTTTTCTCTGAGAATTCGGAGCAGATGCAACTAGCTGTCGAAGGTGGCCGCTTTGACTCACAAAAGAGATATATACCCACCCACAAGGAATGGAGCAGCGTCGTCTTAAAGCCGAAAGAAAACTCGCAAACCACAGTGGACCACAGTGGACCAGATGACTCCGGCCAAAAAGATACATACCCACCACCAAGGGCGTCGTTTCAAGCTTAAGGCCAAGAAAGAACGCCACTTCGGCCAATTCA

Full Affymetrix probeset data:

Annotations for 1634196_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720