Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634197_at:

>probe:Drosophila_2:1634197_at:523:617; Interrogation_Position=1589; Antisense; TGCATTTTACCTCCCTGCGGATTAT
>probe:Drosophila_2:1634197_at:452:623; Interrogation_Position=1604; Antisense; TGCGGATTATCACGGTGCTCTCTAT
>probe:Drosophila_2:1634197_at:35:611; Interrogation_Position=1643; Antisense; TGACCAGCTATGTTTTCACCACGGC
>probe:Drosophila_2:1634197_at:234:495; Interrogation_Position=1723; Antisense; GTCACAGCCTGGACTTTGCTGGTAG
>probe:Drosophila_2:1634197_at:335:239; Interrogation_Position=1773; Antisense; AATCACCACGGTTATGCGGGCGCAG
>probe:Drosophila_2:1634197_at:724:135; Interrogation_Position=1831; Antisense; ACGCAGCTAGGATCCGCTATCGGAG
>probe:Drosophila_2:1634197_at:157:267; Interrogation_Position=1856; Antisense; CAGTGGCCATCTTCTTTGCGATCAA
>probe:Drosophila_2:1634197_at:513:723; Interrogation_Position=1871; Antisense; TTGCGATCAACTACTCAGACCTTTT
>probe:Drosophila_2:1634197_at:629:697; Interrogation_Position=1892; Antisense; TTTTCCAGGCCGCAGAGTCGAACTG
>probe:Drosophila_2:1634197_at:614:331; Interrogation_Position=1939; Antisense; GCGGCCAGGATTTCCAGGGATGCAT
>probe:Drosophila_2:1634197_at:613:513; Interrogation_Position=2011; Antisense; GTGTATTTTCACCTCAAGTCACAAT
>probe:Drosophila_2:1634197_at:557:375; Interrogation_Position=2036; Antisense; GAAGACAATACCTACCTGAACTCGC
>probe:Drosophila_2:1634197_at:329:283; Interrogation_Position=2051; Antisense; CTGAACTCGCGCTTTTTTATACAAC
>probe:Drosophila_2:1634197_at:500:431; Interrogation_Position=2086; Antisense; TGACTTGCAACCCTTCGTAGTTTTA

Paste this into a BLAST search page for me
TGCATTTTACCTCCCTGCGGATTATTGCGGATTATCACGGTGCTCTCTATTGACCAGCTATGTTTTCACCACGGCGTCACAGCCTGGACTTTGCTGGTAGAATCACCACGGTTATGCGGGCGCAGACGCAGCTAGGATCCGCTATCGGAGCAGTGGCCATCTTCTTTGCGATCAATTGCGATCAACTACTCAGACCTTTTTTTTCCAGGCCGCAGAGTCGAACTGGCGGCCAGGATTTCCAGGGATGCATGTGTATTTTCACCTCAAGTCACAATGAAGACAATACCTACCTGAACTCGCCTGAACTCGCGCTTTTTTATACAACTGACTTGCAACCCTTCGTAGTTTTA

Full Affymetrix probeset data:

Annotations for 1634197_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime