Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634198_at:

>probe:Drosophila_2:1634198_at:316:443; Interrogation_Position=290; Antisense; GATGTCGCGTATGTCGCATATGCTA
>probe:Drosophila_2:1634198_at:229:25; Interrogation_Position=307; Antisense; ATATGCTAGCACTACTACTGGTACT
>probe:Drosophila_2:1634198_at:495:247; Interrogation_Position=332; Antisense; AATTGCCAGTAGTCAGGCGCTCGAG
>probe:Drosophila_2:1634198_at:459:503; Interrogation_Position=363; Antisense; GTCCAGCCCACTTGCAATCTAAAGG
>probe:Drosophila_2:1634198_at:400:327; Interrogation_Position=403; Antisense; GCGATAATCTTCTGGCCGGAACAAA
>probe:Drosophila_2:1634198_at:171:387; Interrogation_Position=421; Antisense; GAACAAATTCCGCATCCGATGCTGG
>probe:Drosophila_2:1634198_at:155:53; Interrogation_Position=439; Antisense; ATGCTGGCGATGTGTCTGCCGATAA
>probe:Drosophila_2:1634198_at:177:651; Interrogation_Position=520; Antisense; TATTTGCGGACGATGCGACGACAAC
>probe:Drosophila_2:1634198_at:726:429; Interrogation_Position=572; Antisense; GAGTCAGTTGCATGCGGTAACGCCT
>probe:Drosophila_2:1634198_at:194:221; Interrogation_Position=674; Antisense; AAGTGGGCGATCCATTACTTTCTCA
>probe:Drosophila_2:1634198_at:413:11; Interrogation_Position=687; Antisense; ATTACTTTCTCACGACGACGACGAC
>probe:Drosophila_2:1634198_at:523:727; Interrogation_Position=730; Antisense; TTGGGCACTTTGAACACTCGATCGG
>probe:Drosophila_2:1634198_at:380:637; Interrogation_Position=747; Antisense; TCGATCGGCGATTTCTGCAATTGTA
>probe:Drosophila_2:1634198_at:701:69; Interrogation_Position=800; Antisense; AGGCGCGTGCGTCAAATCAAAATCA

Paste this into a BLAST search page for me
GATGTCGCGTATGTCGCATATGCTAATATGCTAGCACTACTACTGGTACTAATTGCCAGTAGTCAGGCGCTCGAGGTCCAGCCCACTTGCAATCTAAAGGGCGATAATCTTCTGGCCGGAACAAAGAACAAATTCCGCATCCGATGCTGGATGCTGGCGATGTGTCTGCCGATAATATTTGCGGACGATGCGACGACAACGAGTCAGTTGCATGCGGTAACGCCTAAGTGGGCGATCCATTACTTTCTCAATTACTTTCTCACGACGACGACGACTTGGGCACTTTGAACACTCGATCGGTCGATCGGCGATTTCTGCAATTGTAAGGCGCGTGCGTCAAATCAAAATCA

Full Affymetrix probeset data:

Annotations for 1634198_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime