FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634201_at:

>probe:Drosophila_2:1634201_at:481:379; Interrogation_Position=132; Antisense; GAAGCCAACCAGCAGCGCGATGAAA
>probe:Drosophila_2:1634201_at:460:409; Interrogation_Position=189; Antisense; GACGAGGAACCCGAACTGATCATCA
>probe:Drosophila_2:1634201_at:525:35; Interrogation_Position=207; Antisense; ATCATCACGGGCAAACGAACCTCTT
>probe:Drosophila_2:1634201_at:80:389; Interrogation_Position=273; Antisense; GAAACGGCCACCTATGTGGCGGATA
>probe:Drosophila_2:1634201_at:155:219; Interrogation_Position=315; Antisense; AAGTACAACATCACCTTGGATACCG
>probe:Drosophila_2:1634201_at:600:729; Interrogation_Position=330; Antisense; TTGGATACCGTGGAGCTTGACCGTC
>probe:Drosophila_2:1634201_at:42:635; Interrogation_Position=353; Antisense; TCGCCTCAGCGGACAAGCACTTAAG
>probe:Drosophila_2:1634201_at:188:209; Interrogation_Position=367; Antisense; AAGCACTTAAGACCACCGCTGGTTA
>probe:Drosophila_2:1634201_at:347:333; Interrogation_Position=384; Antisense; GCTGGTTAGGCGACACATCGAGTAT
>probe:Drosophila_2:1634201_at:413:611; Interrogation_Position=469; Antisense; TGACACGTTCTCAAAGCACCATTGC
>probe:Drosophila_2:1634201_at:304:719; Interrogation_Position=543; Antisense; TTCCCAAACGGATGACAGTGCAGTA
>probe:Drosophila_2:1634201_at:379:67; Interrogation_Position=572; Antisense; ATGGCACTTTGTTTTGGCTTTGTTC
>probe:Drosophila_2:1634201_at:480:455; Interrogation_Position=653; Antisense; GATACACGATCTACAGATGCGGTCA
>probe:Drosophila_2:1634201_at:523:239; Interrogation_Position=90; Antisense; AATCATGCCGACACCAAAGTGCTTT

Paste this into a BLAST search page for me
GAAGCCAACCAGCAGCGCGATGAAAGACGAGGAACCCGAACTGATCATCAATCATCACGGGCAAACGAACCTCTTGAAACGGCCACCTATGTGGCGGATAAAGTACAACATCACCTTGGATACCGTTGGATACCGTGGAGCTTGACCGTCTCGCCTCAGCGGACAAGCACTTAAGAAGCACTTAAGACCACCGCTGGTTAGCTGGTTAGGCGACACATCGAGTATTGACACGTTCTCAAAGCACCATTGCTTCCCAAACGGATGACAGTGCAGTAATGGCACTTTGTTTTGGCTTTGTTCGATACACGATCTACAGATGCGGTCAAATCATGCCGACACCAAAGTGCTTT

Full Affymetrix probeset data:

Annotations for 1634201_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720