FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634203_at:

>probe:Drosophila_2:1634203_at:236:667; Interrogation_Position=537; Antisense; TACTATAACGCACCTGTGACGTACC
>probe:Drosophila_2:1634203_at:705:353; Interrogation_Position=546; Antisense; GCACCTGTGACGTACCCATGTAAGT
>probe:Drosophila_2:1634203_at:444:507; Interrogation_Position=552; Antisense; GTGACGTACCCATGTAAGTCCGGTC
>probe:Drosophila_2:1634203_at:486:487; Interrogation_Position=557; Antisense; GTACCCATGTAAGTCCGGTCCAGGT
>probe:Drosophila_2:1634203_at:269:595; Interrogation_Position=564; Antisense; TGTAAGTCCGGTCCAGGTCCGTCCA
>probe:Drosophila_2:1634203_at:428:599; Interrogation_Position=599; Antisense; TGTCTGTCCGTCTGCTTGTCCATCT
>probe:Drosophila_2:1634203_at:501:727; Interrogation_Position=614; Antisense; TTGTCCATCTGTCACGGCGCTGGGC
>probe:Drosophila_2:1634203_at:421:333; Interrogation_Position=632; Antisense; GCTGGGCGTCCGTAGAACGTCACAG
>probe:Drosophila_2:1634203_at:267:503; Interrogation_Position=639; Antisense; GTCCGTAGAACGTCACAGCATCTGG
>probe:Drosophila_2:1634203_at:35:383; Interrogation_Position=646; Antisense; GAACGTCACAGCATCTGGAACATGT
>probe:Drosophila_2:1634203_at:376:495; Interrogation_Position=650; Antisense; GTCACAGCATCTGGAACATGTGCTT
>probe:Drosophila_2:1634203_at:657:189; Interrogation_Position=664; Antisense; AACATGTGCTTGTGGTGACGCTTCA
>probe:Drosophila_2:1634203_at:267:611; Interrogation_Position=679; Antisense; TGACGCTTCATGTCCTTTTGCAGGA
>probe:Drosophila_2:1634203_at:20:647; Interrogation_Position=686; Antisense; TCATGTCCTTTTGCAGGAGCTTTAT

Paste this into a BLAST search page for me
TACTATAACGCACCTGTGACGTACCGCACCTGTGACGTACCCATGTAAGTGTGACGTACCCATGTAAGTCCGGTCGTACCCATGTAAGTCCGGTCCAGGTTGTAAGTCCGGTCCAGGTCCGTCCATGTCTGTCCGTCTGCTTGTCCATCTTTGTCCATCTGTCACGGCGCTGGGCGCTGGGCGTCCGTAGAACGTCACAGGTCCGTAGAACGTCACAGCATCTGGGAACGTCACAGCATCTGGAACATGTGTCACAGCATCTGGAACATGTGCTTAACATGTGCTTGTGGTGACGCTTCATGACGCTTCATGTCCTTTTGCAGGATCATGTCCTTTTGCAGGAGCTTTAT

Full Affymetrix probeset data:

Annotations for 1634203_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720