FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634204_at:

>probe:Drosophila_2:1634204_at:289:327; Interrogation_Position=206; Antisense; GCGAGATTACGACGCTGCTGACGCA
>probe:Drosophila_2:1634204_at:336:561; Interrogation_Position=232; Antisense; GGAAAATCCGTGGAGGCGCTCCTGA
>probe:Drosophila_2:1634204_at:533:229; Interrogation_Position=295; Antisense; AATGTGAAGGACCACGCCCTGAACA
>probe:Drosophila_2:1634204_at:461:613; Interrogation_Position=314; Antisense; TGAACATCACGCTGCGGGTGCTGCT
>probe:Drosophila_2:1634204_at:713:333; Interrogation_Position=336; Antisense; GCTGTCCATCAAGTCGACGCAAATG
>probe:Drosophila_2:1634204_at:306:397; Interrogation_Position=373; Antisense; GACACCTTGGACCAGAACGACCTAA
>probe:Drosophila_2:1634204_at:710:83; Interrogation_Position=470; Antisense; AGTGGCATGAGAAGGCCTTCGCCAA
>probe:Drosophila_2:1634204_at:82:599; Interrogation_Position=524; Antisense; TGTCCGACACAAATCGCGCCTAGAG
>probe:Drosophila_2:1634204_at:62:313; Interrogation_Position=561; Antisense; GCCAAAGGCGGTCATAGAGTCACTA
>probe:Drosophila_2:1634204_at:48:177; Interrogation_Position=608; Antisense; AAACCGATTCATACGCATCGCGGAG
>probe:Drosophila_2:1634204_at:349:347; Interrogation_Position=622; Antisense; GCATCGCGGAGCATTTAATCAACAC
>probe:Drosophila_2:1634204_at:96:543; Interrogation_Position=648; Antisense; GGATTGGAGCACTGGACACCACATC
>probe:Drosophila_2:1634204_at:489:155; Interrogation_Position=663; Antisense; ACACCACATCCTTATCTTCGGGATT
>probe:Drosophila_2:1634204_at:287:477; Interrogation_Position=716; Antisense; GTTTCTTCGCCGCAATACAAATGAC

Paste this into a BLAST search page for me
GCGAGATTACGACGCTGCTGACGCAGGAAAATCCGTGGAGGCGCTCCTGAAATGTGAAGGACCACGCCCTGAACATGAACATCACGCTGCGGGTGCTGCTGCTGTCCATCAAGTCGACGCAAATGGACACCTTGGACCAGAACGACCTAAAGTGGCATGAGAAGGCCTTCGCCAATGTCCGACACAAATCGCGCCTAGAGGCCAAAGGCGGTCATAGAGTCACTAAAACCGATTCATACGCATCGCGGAGGCATCGCGGAGCATTTAATCAACACGGATTGGAGCACTGGACACCACATCACACCACATCCTTATCTTCGGGATTGTTTCTTCGCCGCAATACAAATGAC

Full Affymetrix probeset data:

Annotations for 1634204_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720