FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634205_at:

>probe:Drosophila_2:1634205_at:386:303; Interrogation_Position=266; Antisense; CCGAGCATCGCAACCATATTCTAAG
>probe:Drosophila_2:1634205_at:358:187; Interrogation_Position=308; Antisense; AACAAAGTTCTTGCTTGGTCTTCAA
>probe:Drosophila_2:1634205_at:729:703; Interrogation_Position=357; Antisense; TTATGTGAATGTTACCTCGGAGGCT
>probe:Drosophila_2:1634205_at:506:473; Interrogation_Position=389; Antisense; GTTACTCGTATGTTGGCTATCGCAA
>probe:Drosophila_2:1634205_at:137:637; Interrogation_Position=408; Antisense; TCGCAACCGGGTTCAGCAGCTGAAT
>probe:Drosophila_2:1634205_at:576:613; Interrogation_Position=428; Antisense; TGAATCTGCAGACCTACGCTCTGGA
>probe:Drosophila_2:1634205_at:143:185; Interrogation_Position=474; Antisense; AACAATTGTCCACGAGTTCCTGCAT
>probe:Drosophila_2:1634205_at:591:209; Interrogation_Position=522; Antisense; AAGCACCTGGAATCGCGATGACTAT
>probe:Drosophila_2:1634205_at:315:607; Interrogation_Position=573; Antisense; TGAGGGCACTGAGGGCAACTTCAAC
>probe:Drosophila_2:1634205_at:215:107; Interrogation_Position=630; Antisense; AGAACCCTATGATTACTCCAGTGTA
>probe:Drosophila_2:1634205_at:234:261; Interrogation_Position=663; Antisense; CACCGCTTATGCGTTCTCTAAAAAC
>probe:Drosophila_2:1634205_at:97:427; Interrogation_Position=689; Antisense; GAGAGATGACCATTGTGCCGCTACA
>probe:Drosophila_2:1634205_at:139:569; Interrogation_Position=737; Antisense; GGCAGCGATTGCAAATGACCCAGTC
>probe:Drosophila_2:1634205_at:632:505; Interrogation_Position=792; Antisense; GTGCCCCAGGCAGGTGTAATAAATA

Paste this into a BLAST search page for me
CCGAGCATCGCAACCATATTCTAAGAACAAAGTTCTTGCTTGGTCTTCAATTATGTGAATGTTACCTCGGAGGCTGTTACTCGTATGTTGGCTATCGCAATCGCAACCGGGTTCAGCAGCTGAATTGAATCTGCAGACCTACGCTCTGGAAACAATTGTCCACGAGTTCCTGCATAAGCACCTGGAATCGCGATGACTATTGAGGGCACTGAGGGCAACTTCAACAGAACCCTATGATTACTCCAGTGTACACCGCTTATGCGTTCTCTAAAAACGAGAGATGACCATTGTGCCGCTACAGGCAGCGATTGCAAATGACCCAGTCGTGCCCCAGGCAGGTGTAATAAATA

Full Affymetrix probeset data:

Annotations for 1634205_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720