FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634206_at:

>probe:Drosophila_2:1634206_at:148:291; Interrogation_Position=2277; Antisense; CGTTCGTCGCGATCCATTGTATGGT
>probe:Drosophila_2:1634206_at:384:3; Interrogation_Position=2292; Antisense; ATTGTATGGTTGATGCCGTCGTCAG
>probe:Drosophila_2:1634206_at:96:201; Interrogation_Position=2329; Antisense; AACGCTCGCTTGGTGTACTCGTAGA
>probe:Drosophila_2:1634206_at:172:155; Interrogation_Position=2392; Antisense; ACAGATGGCAGCAGGCCGCGATAGA
>probe:Drosophila_2:1634206_at:729:25; Interrogation_Position=2412; Antisense; ATAGAGTGCCAGGACACCTTCGCGA
>probe:Drosophila_2:1634206_at:296:153; Interrogation_Position=2462; Antisense; ACATGCTTTCGTTGAGGTTCTTCAC
>probe:Drosophila_2:1634206_at:178:715; Interrogation_Position=2479; Antisense; TTCTTCACCTGTATGCGACTCTTAA
>probe:Drosophila_2:1634206_at:710:325; Interrogation_Position=2493; Antisense; GCGACTCTTAATTACGTCTGCAGGA
>probe:Drosophila_2:1634206_at:82:389; Interrogation_Position=2516; Antisense; GAAACGTCGACGTCCAGAGGCAGAC
>probe:Drosophila_2:1634206_at:238:453; Interrogation_Position=2559; Antisense; GATCATCGTACGCAGTGGTCCAATA
>probe:Drosophila_2:1634206_at:598:37; Interrogation_Position=2586; Antisense; ATCTTTGGATTGATCATCCCTGCAA
>probe:Drosophila_2:1634206_at:686:189; Interrogation_Position=2648; Antisense; AACTTTGTCCAACATCTTTCATTTG
>probe:Drosophila_2:1634206_at:425:375; Interrogation_Position=2684; Antisense; GAAGATCGAGTTATCTGTCCAGCTA
>probe:Drosophila_2:1634206_at:174:383; Interrogation_Position=2792; Antisense; GAACGATTGTTGTTCACTCGTAAAC

Paste this into a BLAST search page for me
CGTTCGTCGCGATCCATTGTATGGTATTGTATGGTTGATGCCGTCGTCAGAACGCTCGCTTGGTGTACTCGTAGAACAGATGGCAGCAGGCCGCGATAGAATAGAGTGCCAGGACACCTTCGCGAACATGCTTTCGTTGAGGTTCTTCACTTCTTCACCTGTATGCGACTCTTAAGCGACTCTTAATTACGTCTGCAGGAGAAACGTCGACGTCCAGAGGCAGACGATCATCGTACGCAGTGGTCCAATAATCTTTGGATTGATCATCCCTGCAAAACTTTGTCCAACATCTTTCATTTGGAAGATCGAGTTATCTGTCCAGCTAGAACGATTGTTGTTCACTCGTAAAC

Full Affymetrix probeset data:

Annotations for 1634206_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720