FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634207_at:

>probe:Drosophila_2:1634207_at:322:455; Interrogation_Position=166; Antisense; GATAGTTCCAGTGCTGATCCTGCTG
>probe:Drosophila_2:1634207_at:469:449; Interrogation_Position=181; Antisense; GATCCTGCTGCAGCTGGGAATCGAG
>probe:Drosophila_2:1634207_at:463:35; Interrogation_Position=225; Antisense; ATCAGCGCTGCGAACTCACAAGAGT
>probe:Drosophila_2:1634207_at:727:515; Interrogation_Position=253; Antisense; GGTGGAGAACTACAACTTCGACAAG
>probe:Drosophila_2:1634207_at:521:395; Interrogation_Position=272; Antisense; GACAAGACCTTCATTTCCAACTGGA
>probe:Drosophila_2:1634207_at:71:143; Interrogation_Position=291; Antisense; ACTGGATCTGTTTGGTGGAGCACGA
>probe:Drosophila_2:1634207_at:79:385; Interrogation_Position=364; Antisense; GAACTATGGCCTCTTTCAGATCAAC
>probe:Drosophila_2:1634207_at:400:511; Interrogation_Position=441; Antisense; GTGAAGACTTCTCCAATGACGACAT
>probe:Drosophila_2:1634207_at:139:411; Interrogation_Position=458; Antisense; GACGACATCAGTGACGACATCGCCT
>probe:Drosophila_2:1634207_at:552:57; Interrogation_Position=491; Antisense; ATGATCCAGGAACGCGAGGGCTTCA
>probe:Drosophila_2:1634207_at:246:669; Interrogation_Position=518; Antisense; TACTGGAAGGGCTGGGATCGCTTCT
>probe:Drosophila_2:1634207_at:38:509; Interrogation_Position=605; Antisense; GTGCGATCACCTCGTGGATTCTTAA
>probe:Drosophila_2:1634207_at:324:545; Interrogation_Position=61; Antisense; GGATCCGATCGGGTGTGCAAATCAT
>probe:Drosophila_2:1634207_at:199:591; Interrogation_Position=99; Antisense; TGTGTTTGAAAGCACGCCATCCCAA

Paste this into a BLAST search page for me
GATAGTTCCAGTGCTGATCCTGCTGGATCCTGCTGCAGCTGGGAATCGAGATCAGCGCTGCGAACTCACAAGAGTGGTGGAGAACTACAACTTCGACAAGGACAAGACCTTCATTTCCAACTGGAACTGGATCTGTTTGGTGGAGCACGAGAACTATGGCCTCTTTCAGATCAACGTGAAGACTTCTCCAATGACGACATGACGACATCAGTGACGACATCGCCTATGATCCAGGAACGCGAGGGCTTCATACTGGAAGGGCTGGGATCGCTTCTGTGCGATCACCTCGTGGATTCTTAAGGATCCGATCGGGTGTGCAAATCATTGTGTTTGAAAGCACGCCATCCCAA

Full Affymetrix probeset data:

Annotations for 1634207_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720