FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634209_at:

>probe:Drosophila_2:1634209_at:256:501; Interrogation_Position=435; Antisense; GTCGTCAATTTGTTCAACTACACTG
>probe:Drosophila_2:1634209_at:5:191; Interrogation_Position=450; Antisense; AACTACACTGACTTTCCGAACGAGA
>probe:Drosophila_2:1634209_at:59:385; Interrogation_Position=485; Antisense; GAACTGCAGCAAGCCGGTCACAGAG
>probe:Drosophila_2:1634209_at:167:703; Interrogation_Position=557; Antisense; TTATCTTGATCTGCGCACATTGGAA
>probe:Drosophila_2:1634209_at:3:691; Interrogation_Position=587; Antisense; TTTGGAAAACAGATGCCTTCCGCCC
>probe:Drosophila_2:1634209_at:585:297; Interrogation_Position=610; Antisense; CCCTAGATTTTACTGACCTGCCATA
>probe:Drosophila_2:1634209_at:212:285; Interrogation_Position=622; Antisense; CTGACCTGCCATACATATACAACAC
>probe:Drosophila_2:1634209_at:342:189; Interrogation_Position=651; Antisense; AACATGGAGCCTGCAGAGCCTGAAT
>probe:Drosophila_2:1634209_at:420:115; Interrogation_Position=781; Antisense; AGCTAGGTATCTTTGTACTACTAAT
>probe:Drosophila_2:1634209_at:504:389; Interrogation_Position=833; Antisense; GAAACTGTTATACCATTAGCTATCC
>probe:Drosophila_2:1634209_at:404:117; Interrogation_Position=850; Antisense; AGCTATCCAAGTTTGTTGTCTCGAA
>probe:Drosophila_2:1634209_at:182:603; Interrogation_Position=863; Antisense; TGTTGTCTCGAATCACATTTGTGAA
>probe:Drosophila_2:1634209_at:394:659; Interrogation_Position=924; Antisense; TAAGAACCGACATTAAGCCTCCAAC
>probe:Drosophila_2:1634209_at:348:431; Interrogation_Position=967; Antisense; GATGTACCTCGTTTGGAAGTGATTT

Paste this into a BLAST search page for me
GTCGTCAATTTGTTCAACTACACTGAACTACACTGACTTTCCGAACGAGAGAACTGCAGCAAGCCGGTCACAGAGTTATCTTGATCTGCGCACATTGGAATTTGGAAAACAGATGCCTTCCGCCCCCCTAGATTTTACTGACCTGCCATACTGACCTGCCATACATATACAACACAACATGGAGCCTGCAGAGCCTGAATAGCTAGGTATCTTTGTACTACTAATGAAACTGTTATACCATTAGCTATCCAGCTATCCAAGTTTGTTGTCTCGAATGTTGTCTCGAATCACATTTGTGAATAAGAACCGACATTAAGCCTCCAACGATGTACCTCGTTTGGAAGTGATTT

Full Affymetrix probeset data:

Annotations for 1634209_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720