FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634210_at:

>probe:Drosophila_2:1634210_at:275:31; Interrogation_Position=122; Antisense; ATAACGTGGCTGGTGAGCCGGTTCT
>probe:Drosophila_2:1634210_at:660:415; Interrogation_Position=136; Antisense; GAGCCGGTTCTTCACGAGCGGACTT
>probe:Drosophila_2:1634210_at:300:609; Interrogation_Position=14; Antisense; TGAGATTTGTCTTTATGGCCGCTTT
>probe:Drosophila_2:1634210_at:498:417; Interrogation_Position=151; Antisense; GAGCGGACTTCTTGGGACTTTGATC
>probe:Drosophila_2:1634210_at:164:101; Interrogation_Position=188; Antisense; AGAGGGCCAGATCGCTGTACTACGA
>probe:Drosophila_2:1634210_at:223:423; Interrogation_Position=211; Antisense; GAGAAGAACGGATTCCGCTCGTCCA
>probe:Drosophila_2:1634210_at:506:9; Interrogation_Position=222; Antisense; ATTCCGCTCGTCCAAATTCATCGAG
>probe:Drosophila_2:1634210_at:45:13; Interrogation_Position=237; Antisense; ATTCATCGAGCGACTGGGCGTTGGT
>probe:Drosophila_2:1634210_at:404:401; Interrogation_Position=299; Antisense; GACATCGCGATGTGGGACGACTGAA
>probe:Drosophila_2:1634210_at:173:387; Interrogation_Position=328; Antisense; GAACACAATGTGAACTATCCGCCTC
>probe:Drosophila_2:1634210_at:692:467; Interrogation_Position=51; Antisense; GTTGCTTCTACTTCAGTTTAGTCCA
>probe:Drosophila_2:1634210_at:654:91; Interrogation_Position=65; Antisense; AGTTTAGTCCACCTGCAGATGGCTT
>probe:Drosophila_2:1634210_at:324:351; Interrogation_Position=79; Antisense; GCAGATGGCTTTATCATTCGACTGA
>probe:Drosophila_2:1634210_at:293:11; Interrogation_Position=94; Antisense; ATTCGACTGATTACGGAGACACTGC

Paste this into a BLAST search page for me
ATAACGTGGCTGGTGAGCCGGTTCTGAGCCGGTTCTTCACGAGCGGACTTTGAGATTTGTCTTTATGGCCGCTTTGAGCGGACTTCTTGGGACTTTGATCAGAGGGCCAGATCGCTGTACTACGAGAGAAGAACGGATTCCGCTCGTCCAATTCCGCTCGTCCAAATTCATCGAGATTCATCGAGCGACTGGGCGTTGGTGACATCGCGATGTGGGACGACTGAAGAACACAATGTGAACTATCCGCCTCGTTGCTTCTACTTCAGTTTAGTCCAAGTTTAGTCCACCTGCAGATGGCTTGCAGATGGCTTTATCATTCGACTGAATTCGACTGATTACGGAGACACTGC

Full Affymetrix probeset data:

Annotations for 1634210_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720