FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634211_at:

>probe:Drosophila_2:1634211_at:119:451; Interrogation_Position=5442; Antisense; GATCTCGTTAAGTTTCATTTTGCCA
>probe:Drosophila_2:1634211_at:467:477; Interrogation_Position=5453; Antisense; GTTTCATTTTGCCAGATAGCCCGAA
>probe:Drosophila_2:1634211_at:282:455; Interrogation_Position=5467; Antisense; GATAGCCCGAAATAGATTGCAGTAC
>probe:Drosophila_2:1634211_at:572:159; Interrogation_Position=5490; Antisense; ACAATGCTTTGCAGCTACCATACGC
>probe:Drosophila_2:1634211_at:90:351; Interrogation_Position=5526; Antisense; GCAGATTATTAGCAATTACCTTAGG
>probe:Drosophila_2:1634211_at:38:689; Interrogation_Position=5565; Antisense; TATTCGATAGGTGAGACAGTCTTTT
>probe:Drosophila_2:1634211_at:364:89; Interrogation_Position=5582; Antisense; AGTCTTTTGAAATTCCGTGTGCCAA
>probe:Drosophila_2:1634211_at:497:289; Interrogation_Position=5597; Antisense; CGTGTGCCAAATTTTCCGAAACCTG
>probe:Drosophila_2:1634211_at:292:157; Interrogation_Position=5669; Antisense; AAATGCATTTAACGCCTAGACTTAG
>probe:Drosophila_2:1634211_at:705:409; Interrogation_Position=5748; Antisense; GACGAATATGCGACTAATTGAACTG
>probe:Drosophila_2:1634211_at:668:219; Interrogation_Position=5799; Antisense; AAGTGCCTCATTAATACGTGTGTTT
>probe:Drosophila_2:1634211_at:326:477; Interrogation_Position=5827; Antisense; GTTTAATCTTTAATCCTCCTATATC
>probe:Drosophila_2:1634211_at:42:91; Interrogation_Position=5879; Antisense; AGTTAGTTATTCATACGACGTAGGT
>probe:Drosophila_2:1634211_at:215:137; Interrogation_Position=5893; Antisense; ACGACGTAGGTCTTTGCAATAAACA

Paste this into a BLAST search page for me
GATCTCGTTAAGTTTCATTTTGCCAGTTTCATTTTGCCAGATAGCCCGAAGATAGCCCGAAATAGATTGCAGTACACAATGCTTTGCAGCTACCATACGCGCAGATTATTAGCAATTACCTTAGGTATTCGATAGGTGAGACAGTCTTTTAGTCTTTTGAAATTCCGTGTGCCAACGTGTGCCAAATTTTCCGAAACCTGAAATGCATTTAACGCCTAGACTTAGGACGAATATGCGACTAATTGAACTGAAGTGCCTCATTAATACGTGTGTTTGTTTAATCTTTAATCCTCCTATATCAGTTAGTTATTCATACGACGTAGGTACGACGTAGGTCTTTGCAATAAACA

Full Affymetrix probeset data:

Annotations for 1634211_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720