FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634213_at:

>probe:Drosophila_2:1634213_at:582:701; Interrogation_Position=243; Antisense; TTTTCAAAACTGTCCCACCAAGGCA
>probe:Drosophila_2:1634213_at:701:71; Interrogation_Position=269; Antisense; AGGCTCGTCGCAGTTCGGCCAAGAT
>probe:Drosophila_2:1634213_at:39:45; Interrogation_Position=292; Antisense; ATCGCCCTAATGAATTCCGTCTTTA
>probe:Drosophila_2:1634213_at:245:707; Interrogation_Position=314; Antisense; TTAATGAGCATCCATCGCGTCGAAT
>probe:Drosophila_2:1634213_at:656:167; Interrogation_Position=357; Antisense; AAAGGCGGTTCAGGATGCTCGCACT
>probe:Drosophila_2:1634213_at:358:291; Interrogation_Position=422; Antisense; CGGGCATCGGAGCATTCAGATTCAT
>probe:Drosophila_2:1634213_at:686:469; Interrogation_Position=480; Antisense; GTTCCAGGAGCTTATGACCGTGTTC
>probe:Drosophila_2:1634213_at:335:193; Interrogation_Position=506; Antisense; AACTGCTTCACTGGAACGGATCGCT
>probe:Drosophila_2:1634213_at:492:517; Interrogation_Position=568; Antisense; GTGGTGGCTCATTATTCGAACCGGA
>probe:Drosophila_2:1634213_at:578:283; Interrogation_Position=584; Antisense; CGAACCGGAGCCTGGACGACGAGAT
>probe:Drosophila_2:1634213_at:161:33; Interrogation_Position=650; Antisense; ATAATCCAGGCGTTATTCGCAGGGA
>probe:Drosophila_2:1634213_at:494:99; Interrogation_Position=689; Antisense; AGAGGGAGCTGGAGACCTTTCGCAT
>probe:Drosophila_2:1634213_at:304:291; Interrogation_Position=721; Antisense; CGTGAATTGCGCTTTCCGAAGGAGA
>probe:Drosophila_2:1634213_at:397:709; Interrogation_Position=794; Antisense; TTAACTCGGCTACCATTGATGATTA

Paste this into a BLAST search page for me
TTTTCAAAACTGTCCCACCAAGGCAAGGCTCGTCGCAGTTCGGCCAAGATATCGCCCTAATGAATTCCGTCTTTATTAATGAGCATCCATCGCGTCGAATAAAGGCGGTTCAGGATGCTCGCACTCGGGCATCGGAGCATTCAGATTCATGTTCCAGGAGCTTATGACCGTGTTCAACTGCTTCACTGGAACGGATCGCTGTGGTGGCTCATTATTCGAACCGGACGAACCGGAGCCTGGACGACGAGATATAATCCAGGCGTTATTCGCAGGGAAGAGGGAGCTGGAGACCTTTCGCATCGTGAATTGCGCTTTCCGAAGGAGATTAACTCGGCTACCATTGATGATTA

Full Affymetrix probeset data:

Annotations for 1634213_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720