Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634216_at:

>probe:Drosophila_2:1634216_at:185:571; Interrogation_Position=1220; Antisense; GGCTTTTCCTACACGGCGGAGAGAC
>probe:Drosophila_2:1634216_at:665:535; Interrogation_Position=1255; Antisense; GGTGCCTCAACGGACATTAATCTGC
>probe:Drosophila_2:1634216_at:184:333; Interrogation_Position=1278; Antisense; GCTGGACGCCCTTTTGATGAACACA
>probe:Drosophila_2:1634216_at:595:3; Interrogation_Position=1309; Antisense; ATTGGTCATGGTTATGCTCTGGCTA
>probe:Drosophila_2:1634216_at:251:207; Interrogation_Position=1333; Antisense; AAGCATCCGATTCTCCTGAATGCAG
>probe:Drosophila_2:1634216_at:118:369; Interrogation_Position=1350; Antisense; GAATGCAGTCAAGTCACGCCGGATT
>probe:Drosophila_2:1634216_at:236:543; Interrogation_Position=1370; Antisense; GGATTGCCGTGGAGCTTAGTCCCAT
>probe:Drosophila_2:1634216_at:536:87; Interrogation_Position=1387; Antisense; AGTCCCATTTCGAATCAGGTGCTGC
>probe:Drosophila_2:1634216_at:194:619; Interrogation_Position=1409; Antisense; TGCATCTGGTTTGGGACCTGCGCAA
>probe:Drosophila_2:1634216_at:719:61; Interrogation_Position=1463; Antisense; ATGTGCCCGTGGTGATATGCAACGA
>probe:Drosophila_2:1634216_at:166:683; Interrogation_Position=1478; Antisense; TATGCAACGATGATCCTGGCTTCTG
>probe:Drosophila_2:1634216_at:336:49; Interrogation_Position=1505; Antisense; ATGCCAAGGGTCTGAGCTACGATTT
>probe:Drosophila_2:1634216_at:200:247; Interrogation_Position=1597; Antisense; AATTCGGTGCGATACTCCACGCTGA
>probe:Drosophila_2:1634216_at:505:193; Interrogation_Position=1658; Antisense; AACTCAGCTGGTCGCGATTCATAGA

Paste this into a BLAST search page for me
GGCTTTTCCTACACGGCGGAGAGACGGTGCCTCAACGGACATTAATCTGCGCTGGACGCCCTTTTGATGAACACAATTGGTCATGGTTATGCTCTGGCTAAAGCATCCGATTCTCCTGAATGCAGGAATGCAGTCAAGTCACGCCGGATTGGATTGCCGTGGAGCTTAGTCCCATAGTCCCATTTCGAATCAGGTGCTGCTGCATCTGGTTTGGGACCTGCGCAAATGTGCCCGTGGTGATATGCAACGATATGCAACGATGATCCTGGCTTCTGATGCCAAGGGTCTGAGCTACGATTTAATTCGGTGCGATACTCCACGCTGAAACTCAGCTGGTCGCGATTCATAGA

Full Affymetrix probeset data:

Annotations for 1634216_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime