Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634217_s_at:

>probe:Drosophila_2:1634217_s_at:588:215; Interrogation_Position=1017; Antisense; AAGTTGTGCATACCAATTGTTAACA
>probe:Drosophila_2:1634217_s_at:413:33; Interrogation_Position=558; Antisense; ATCAATGGTGGACTGCGCGTAACTC
>probe:Drosophila_2:1634217_s_at:696:491; Interrogation_Position=597; Antisense; GTCAAATACCGGTTCCCTATATACA
>probe:Drosophila_2:1634217_s_at:68:1; Interrogation_Position=604; Antisense; ACCGGTTCCCTATATACAACAGTAT
>probe:Drosophila_2:1634217_s_at:537:7; Interrogation_Position=650; Antisense; GCTATTGATAAAAACGAACCTTCCA
>probe:Drosophila_2:1634217_s_at:676:379; Interrogation_Position=665; Antisense; GAACCTTCCATTTCGGGATCTAGCA
>probe:Drosophila_2:1634217_s_at:150:695; Interrogation_Position=675; Antisense; TTTCGGGATCTAGCAATGTATTTGA
>probe:Drosophila_2:1634217_s_at:718:233; Interrogation_Position=725; Antisense; AATCGAAAACTACCTGCATACGCCC
>probe:Drosophila_2:1634217_s_at:538:27; Interrogation_Position=742; Antisense; ATACGCCCGCGTAAAACAGTCAAGG
>probe:Drosophila_2:1634217_s_at:651:653; Interrogation_Position=761; Antisense; TCAAGGGTCCCTAACGCATACGATA
>probe:Drosophila_2:1634217_s_at:462:183; Interrogation_Position=873; Antisense; AAAATGGTCATTTTCCCTTCACGCA
>probe:Drosophila_2:1634217_s_at:199:15; Interrogation_Position=882; Antisense; ATTTTCCCTTCACGCACGTTGAATT
>probe:Drosophila_2:1634217_s_at:81:135; Interrogation_Position=893; Antisense; ACGCACGTTGAATTTGTCGATGATT
>probe:Drosophila_2:1634217_s_at:474:459; Interrogation_Position=920; Antisense; GATTTAAGCAAAAACTCCACAGAAA

Paste this into a BLAST search page for me
AAGTTGTGCATACCAATTGTTAACAATCAATGGTGGACTGCGCGTAACTCGTCAAATACCGGTTCCCTATATACAACCGGTTCCCTATATACAACAGTATGCTATTGATAAAAACGAACCTTCCAGAACCTTCCATTTCGGGATCTAGCATTTCGGGATCTAGCAATGTATTTGAAATCGAAAACTACCTGCATACGCCCATACGCCCGCGTAAAACAGTCAAGGTCAAGGGTCCCTAACGCATACGATAAAAATGGTCATTTTCCCTTCACGCAATTTTCCCTTCACGCACGTTGAATTACGCACGTTGAATTTGTCGATGATTGATTTAAGCAAAAACTCCACAGAAA

Full Affymetrix probeset data:

Annotations for 1634217_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime