FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634218_at:

>probe:Drosophila_2:1634218_at:220:567; Interrogation_Position=1052; Antisense; GGCACAATAGAGTTTTTGCACTTTT
>probe:Drosophila_2:1634218_at:177:423; Interrogation_Position=1120; Antisense; GAGACATCTAGCACCCGAGTTAAAT
>probe:Drosophila_2:1634218_at:412:705; Interrogation_Position=1216; Antisense; TTATGGATCATGCTTCCGTATCGAT
>probe:Drosophila_2:1634218_at:578:71; Interrogation_Position=1251; Antisense; AGGAACATTTTATAGTCATTACGTA
>probe:Drosophila_2:1634218_at:659:209; Interrogation_Position=774; Antisense; AAGACACTGAGTTGAGTTTCCGTTA
>probe:Drosophila_2:1634218_at:220:413; Interrogation_Position=787; Antisense; GAGTTTCCGTTAGCACAGTATTGTG
>probe:Drosophila_2:1634218_at:45:367; Interrogation_Position=815; Antisense; GAATCGCAAATTTCGCTTTGGACTG
>probe:Drosophila_2:1634218_at:239:715; Interrogation_Position=826; Antisense; TTCGCTTTGGACTGCATTGGTGTGA
>probe:Drosophila_2:1634218_at:525:343; Interrogation_Position=839; Antisense; GCATTGGTGTGATAGAATCGGCATC
>probe:Drosophila_2:1634218_at:285:367; Interrogation_Position=853; Antisense; GAATCGGCATCATGTTCATCATTAT
>probe:Drosophila_2:1634218_at:272:615; Interrogation_Position=939; Antisense; TGAAGGGTCTAAATGGCCCCGGAAT
>probe:Drosophila_2:1634218_at:32:69; Interrogation_Position=951; Antisense; ATGGCCCCGGAATAAGTCAATTTCT
>probe:Drosophila_2:1634218_at:707:493; Interrogation_Position=966; Antisense; GTCAATTTCTGGCATAATCACTTCA
>probe:Drosophila_2:1634218_at:364:149; Interrogation_Position=997; Antisense; ACATATGTTGTACTTCCTTTTTATA

Paste this into a BLAST search page for me
GGCACAATAGAGTTTTTGCACTTTTGAGACATCTAGCACCCGAGTTAAATTTATGGATCATGCTTCCGTATCGATAGGAACATTTTATAGTCATTACGTAAAGACACTGAGTTGAGTTTCCGTTAGAGTTTCCGTTAGCACAGTATTGTGGAATCGCAAATTTCGCTTTGGACTGTTCGCTTTGGACTGCATTGGTGTGAGCATTGGTGTGATAGAATCGGCATCGAATCGGCATCATGTTCATCATTATTGAAGGGTCTAAATGGCCCCGGAATATGGCCCCGGAATAAGTCAATTTCTGTCAATTTCTGGCATAATCACTTCAACATATGTTGTACTTCCTTTTTATA

Full Affymetrix probeset data:

Annotations for 1634218_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720