Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634219_a_at:

>probe:Drosophila_2:1634219_a_at:91:587; Interrogation_Position=413; Antisense; TGGACATTCCACTGCTGGCTGACAA
>probe:Drosophila_2:1634219_a_at:13:579; Interrogation_Position=450; Antisense; GGCCCGCGACTATGGAGTGCTCGAT
>probe:Drosophila_2:1634219_a_at:550:637; Interrogation_Position=470; Antisense; TCGATGAGGAGACTGGCATCCCCTT
>probe:Drosophila_2:1634219_a_at:99:333; Interrogation_Position=497; Antisense; GCGGCCTGTTCATCATCGATGACAA
>probe:Drosophila_2:1634219_a_at:635:107; Interrogation_Position=524; Antisense; AGAACTTGCGCCAGATCACCGTCAA
>probe:Drosophila_2:1634219_a_at:573:197; Interrogation_Position=547; Antisense; AACGATCTGCCCGTAGGTCGCAGTG
>probe:Drosophila_2:1634219_a_at:36:71; Interrogation_Position=596; Antisense; AGGCCTTCCAGTACACCGACAAGTA
>probe:Drosophila_2:1634219_a_at:54:205; Interrogation_Position=646; Antisense; AAGCCCGGCCAGAAGACCATGGTGG
>probe:Drosophila_2:1634219_a_at:465:667; Interrogation_Position=694; Antisense; TACTTCGAGACCACCTCCTAAAGAG
>probe:Drosophila_2:1634219_a_at:693:211; Interrogation_Position=714; Antisense; AAGAGGCTATCTGTTCGCTGAACGG
>probe:Drosophila_2:1634219_a_at:200:47; Interrogation_Position=819; Antisense; ATCCTACACATTAACCCTAGAGCGT
>probe:Drosophila_2:1634219_a_at:708:177; Interrogation_Position=855; Antisense; AAACTGTGAGGCATCTTTCCCTGCA
>probe:Drosophila_2:1634219_a_at:464:359; Interrogation_Position=877; Antisense; GCAACAGCGCCACCCAAAAATAAGA
>probe:Drosophila_2:1634219_a_at:103:181; Interrogation_Position=906; Antisense; AAACACCTGCAGACGCTAAGCGGAA

Paste this into a BLAST search page for me
TGGACATTCCACTGCTGGCTGACAAGGCCCGCGACTATGGAGTGCTCGATTCGATGAGGAGACTGGCATCCCCTTGCGGCCTGTTCATCATCGATGACAAAGAACTTGCGCCAGATCACCGTCAAAACGATCTGCCCGTAGGTCGCAGTGAGGCCTTCCAGTACACCGACAAGTAAAGCCCGGCCAGAAGACCATGGTGGTACTTCGAGACCACCTCCTAAAGAGAAGAGGCTATCTGTTCGCTGAACGGATCCTACACATTAACCCTAGAGCGTAAACTGTGAGGCATCTTTCCCTGCAGCAACAGCGCCACCCAAAAATAAGAAAACACCTGCAGACGCTAAGCGGAA

Full Affymetrix probeset data:

Annotations for 1634219_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime