Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634220_at:

>probe:Drosophila_2:1634220_at:144:305; Interrogation_Position=1101; Antisense; CCTGTCTAGTTCAATTGGATGGTGC
>probe:Drosophila_2:1634220_at:350:351; Interrogation_Position=1124; Antisense; GCAGCAACAGCCTTTCTGGTATAAA
>probe:Drosophila_2:1634220_at:412:175; Interrogation_Position=1146; Antisense; AAAGCCAATCCACGACTGACTTGTC
>probe:Drosophila_2:1634220_at:100:493; Interrogation_Position=1252; Antisense; GTCAATTCAGGGATACTCCAGCATA
>probe:Drosophila_2:1634220_at:81:675; Interrogation_Position=1354; Antisense; TAGCCATAAATACCGAGAGCCTGCA
>probe:Drosophila_2:1634220_at:19:531; Interrogation_Position=1433; Antisense; GGGATTCCATTGATTTCATGTTCTT
>probe:Drosophila_2:1634220_at:276:461; Interrogation_Position=1463; Antisense; GATTCATATTCGGATGCTCGATCAA
>probe:Drosophila_2:1634220_at:539:241; Interrogation_Position=1526; Antisense; AATACTTTGCGCTTGTTGCACGAAT
>probe:Drosophila_2:1634220_at:557:135; Interrogation_Position=1545; Antisense; ACGAATTTCAACTAGCAACGAGCGA
>probe:Drosophila_2:1634220_at:485:197; Interrogation_Position=1561; Antisense; AACGAGCGAAGATCCCTAAGCTCCA
>probe:Drosophila_2:1634220_at:488:659; Interrogation_Position=1577; Antisense; TAAGCTCCACCTTTTTCATCTCCAT
>probe:Drosophila_2:1634220_at:376:271; Interrogation_Position=1599; Antisense; CATAGTTCCTCCACATCAAACGTGC
>probe:Drosophila_2:1634220_at:488:255; Interrogation_Position=1615; Antisense; CAAACGTGCCTCCTCAATTAGTGGA
>probe:Drosophila_2:1634220_at:671:551; Interrogation_Position=1637; Antisense; GGAGAACTATCCTTTAATCATCAAT

Paste this into a BLAST search page for me
CCTGTCTAGTTCAATTGGATGGTGCGCAGCAACAGCCTTTCTGGTATAAAAAAGCCAATCCACGACTGACTTGTCGTCAATTCAGGGATACTCCAGCATATAGCCATAAATACCGAGAGCCTGCAGGGATTCCATTGATTTCATGTTCTTGATTCATATTCGGATGCTCGATCAAAATACTTTGCGCTTGTTGCACGAATACGAATTTCAACTAGCAACGAGCGAAACGAGCGAAGATCCCTAAGCTCCATAAGCTCCACCTTTTTCATCTCCATCATAGTTCCTCCACATCAAACGTGCCAAACGTGCCTCCTCAATTAGTGGAGGAGAACTATCCTTTAATCATCAAT

Full Affymetrix probeset data:

Annotations for 1634220_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime