FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634222_at:

>probe:Drosophila_2:1634222_at:277:533; Interrogation_Position=3066; Antisense; GGTGGCCTCGCTCATAGACAAATTG
>probe:Drosophila_2:1634222_at:423:165; Interrogation_Position=3093; Antisense; AAATCTGGGCGGATTGGCGCGTACC
>probe:Drosophila_2:1634222_at:692:1; Interrogation_Position=3105; Antisense; ATTGGCGCGTACCTGTGAAGTTCTG
>probe:Drosophila_2:1634222_at:444:715; Interrogation_Position=3125; Antisense; TTCTGGGCGTTAATACCCTAATATT
>probe:Drosophila_2:1634222_at:152:111; Interrogation_Position=3237; Antisense; AGAATCGCTTGCTGGATTTCTGCTG
>probe:Drosophila_2:1634222_at:615:423; Interrogation_Position=3274; Antisense; GAGGGTTATAAAATCGTTGGCGCCG
>probe:Drosophila_2:1634222_at:97:467; Interrogation_Position=3289; Antisense; GTTGGCGCCGAGCAAACTGCACACA
>probe:Drosophila_2:1634222_at:171:145; Interrogation_Position=3304; Antisense; ACTGCACACAGCACAAACTTTGTTG
>probe:Drosophila_2:1634222_at:225:565; Interrogation_Position=3379; Antisense; GGAATACCAGCGAACCTTATTGGAT
>probe:Drosophila_2:1634222_at:148:691; Interrogation_Position=3396; Antisense; TATTGGATTCTTGGACTACGCCGTC
>probe:Drosophila_2:1634222_at:445:493; Interrogation_Position=3418; Antisense; GTCGAAATTCCCCAGTATGGCTTAG
>probe:Drosophila_2:1634222_at:227:91; Interrogation_Position=3431; Antisense; AGTATGGCTTAGTGCGCTCTCTAAA
>probe:Drosophila_2:1634222_at:433:507; Interrogation_Position=3442; Antisense; GTGCGCTCTCTAAATGTACATGTGG
>probe:Drosophila_2:1634222_at:275:573; Interrogation_Position=3465; Antisense; GGCTGGATCACTATTTATTTGGGAA

Paste this into a BLAST search page for me
GGTGGCCTCGCTCATAGACAAATTGAAATCTGGGCGGATTGGCGCGTACCATTGGCGCGTACCTGTGAAGTTCTGTTCTGGGCGTTAATACCCTAATATTAGAATCGCTTGCTGGATTTCTGCTGGAGGGTTATAAAATCGTTGGCGCCGGTTGGCGCCGAGCAAACTGCACACAACTGCACACAGCACAAACTTTGTTGGGAATACCAGCGAACCTTATTGGATTATTGGATTCTTGGACTACGCCGTCGTCGAAATTCCCCAGTATGGCTTAGAGTATGGCTTAGTGCGCTCTCTAAAGTGCGCTCTCTAAATGTACATGTGGGGCTGGATCACTATTTATTTGGGAA

Full Affymetrix probeset data:

Annotations for 1634222_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720