FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634224_at:

>probe:Drosophila_2:1634224_at:513:355; Interrogation_Position=446; Antisense; GCACTTGTTTTAATTTGGCCAGCAG
>probe:Drosophila_2:1634224_at:496:169; Interrogation_Position=518; Antisense; AAAGAGTCGCTCTCAACCAGACCTA
>probe:Drosophila_2:1634224_at:120:547; Interrogation_Position=555; Antisense; GGATCCCATGCTGGTTGCTATTCAA
>probe:Drosophila_2:1634224_at:509:533; Interrogation_Position=613; Antisense; GGTGACACCGTGAAGCTGTGCGATT
>probe:Drosophila_2:1634224_at:627:35; Interrogation_Position=679; Antisense; ATCAGGAGTCGCCACAGTATTCACT
>probe:Drosophila_2:1634224_at:24:483; Interrogation_Position=695; Antisense; GTATTCACTCGCAGACAACGTACAT
>probe:Drosophila_2:1634224_at:730:35; Interrogation_Position=718; Antisense; ATCATACCGATGCAGGCGTGCCGAC
>probe:Drosophila_2:1634224_at:42:81; Interrogation_Position=751; Antisense; AGGGATCCCGAAGCGATGGTCGCCA
>probe:Drosophila_2:1634224_at:150:313; Interrogation_Position=772; Antisense; GCCACCGACACTATGATCTGCGTGA
>probe:Drosophila_2:1634224_at:85:191; Interrogation_Position=799; Antisense; AACATGAAGTATACGGCCCAGTGCC
>probe:Drosophila_2:1634224_at:30:41; Interrogation_Position=862; Antisense; ATCTGCGGCATCAATGTGGCTGGTC
>probe:Drosophila_2:1634224_at:85:667; Interrogation_Position=901; Antisense; TACACGGGCGTGGATCTATACATCA
>probe:Drosophila_2:1634224_at:612:35; Interrogation_Position=922; Antisense; ATCAGGGTATACGATGCTCTCGCCT
>probe:Drosophila_2:1634224_at:345:643; Interrogation_Position=939; Antisense; TCTCGCCTTCTCGATAATGGGCATG

Paste this into a BLAST search page for me
GCACTTGTTTTAATTTGGCCAGCAGAAAGAGTCGCTCTCAACCAGACCTAGGATCCCATGCTGGTTGCTATTCAAGGTGACACCGTGAAGCTGTGCGATTATCAGGAGTCGCCACAGTATTCACTGTATTCACTCGCAGACAACGTACATATCATACCGATGCAGGCGTGCCGACAGGGATCCCGAAGCGATGGTCGCCAGCCACCGACACTATGATCTGCGTGAAACATGAAGTATACGGCCCAGTGCCATCTGCGGCATCAATGTGGCTGGTCTACACGGGCGTGGATCTATACATCAATCAGGGTATACGATGCTCTCGCCTTCTCGCCTTCTCGATAATGGGCATG

Full Affymetrix probeset data:

Annotations for 1634224_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720