FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634225_at:

>probe:Drosophila_2:1634225_at:435:215; Interrogation_Position=118; Antisense; AAGTTCACCAACATCAGCGTAGAGT
>probe:Drosophila_2:1634225_at:187:173; Interrogation_Position=148; Antisense; AAAGACTACTGCTCCAGCATCAGGG
>probe:Drosophila_2:1634225_at:357:573; Interrogation_Position=176; Antisense; GGCTGACCGCCAAAGGTGAGCTGAA
>probe:Drosophila_2:1634225_at:679:151; Interrogation_Position=206; Antisense; ACATCCATCTGAATCGCACCTTGAA
>probe:Drosophila_2:1634225_at:197:31; Interrogation_Position=250; Antisense; ATAACGCTCCTGCAGCTGATAGATG
>probe:Drosophila_2:1634225_at:678:359; Interrogation_Position=275; Antisense; GCAAGGATCGGTACCAGACACTCTT
>probe:Drosophila_2:1634225_at:436:105; Interrogation_Position=290; Antisense; AGACACTCTTCAGCTACGACATGGA
>probe:Drosophila_2:1634225_at:304:137; Interrogation_Position=305; Antisense; ACGACATGGACACCTGCAAGACGCT
>probe:Drosophila_2:1634225_at:566:383; Interrogation_Position=334; Antisense; GAACTTCTGCAGTCCAGCTTGATGA
>probe:Drosophila_2:1634225_at:97:531; Interrogation_Position=469; Antisense; GGGTATTTGCCAGCGGGATTCTATC
>probe:Drosophila_2:1634225_at:348:205; Interrogation_Position=53; Antisense; AAGCCCACCAAGATCTGATCCAGAT
>probe:Drosophila_2:1634225_at:298:533; Interrogation_Position=546; Antisense; GGTGGCCACTTTCATACTGGATATA
>probe:Drosophila_2:1634225_at:451:97; Interrogation_Position=80; Antisense; AGATCAGTGCTCTGCGATTCGGACC
>probe:Drosophila_2:1634225_at:653:459; Interrogation_Position=95; Antisense; GATTCGGACCAACTCTTCGAAGTAA

Paste this into a BLAST search page for me
AAGTTCACCAACATCAGCGTAGAGTAAAGACTACTGCTCCAGCATCAGGGGGCTGACCGCCAAAGGTGAGCTGAAACATCCATCTGAATCGCACCTTGAAATAACGCTCCTGCAGCTGATAGATGGCAAGGATCGGTACCAGACACTCTTAGACACTCTTCAGCTACGACATGGAACGACATGGACACCTGCAAGACGCTGAACTTCTGCAGTCCAGCTTGATGAGGGTATTTGCCAGCGGGATTCTATCAAGCCCACCAAGATCTGATCCAGATGGTGGCCACTTTCATACTGGATATAAGATCAGTGCTCTGCGATTCGGACCGATTCGGACCAACTCTTCGAAGTAA

Full Affymetrix probeset data:

Annotations for 1634225_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720