FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634226_at:

>probe:Drosophila_2:1634226_at:365:137; Interrogation_Position=1011; Antisense; ACGAGATTAGCGCTCTAGTGGCCAA
>probe:Drosophila_2:1634226_at:167:109; Interrogation_Position=1108; Antisense; AGAAGCCGCCCGACTTCAGGAAGAG
>probe:Drosophila_2:1634226_at:314:563; Interrogation_Position=1126; Antisense; GGAAGAGCAGTCTCAGATTGCACAA
>probe:Drosophila_2:1634226_at:145:465; Interrogation_Position=1141; Antisense; GATTGCACAAAAGCGCTACCATGAG
>probe:Drosophila_2:1634226_at:1:359; Interrogation_Position=1203; Antisense; GCAAAAATGCCAAGCGCCGGCGGAA
>probe:Drosophila_2:1634226_at:75:403; Interrogation_Position=1253; Antisense; GACATATCTGGGTCTCAGGTGCTAC
>probe:Drosophila_2:1634226_at:458:265; Interrogation_Position=1268; Antisense; CAGGTGCTACCTGATCGCGAGGAAT
>probe:Drosophila_2:1634226_at:119:229; Interrogation_Position=1290; Antisense; AATGGATGCGATCGGCTCTGGCTTC
>probe:Drosophila_2:1634226_at:491:81; Interrogation_Position=1366; Antisense; AGGGACTCGGCGCAAGCACCAGATC
>probe:Drosophila_2:1634226_at:657:369; Interrogation_Position=1411; Antisense; GAAGGCCAACGAAGCCGAGCTGCAG
>probe:Drosophila_2:1634226_at:273:501; Interrogation_Position=1464; Antisense; GTCGGGCCACCCAAAGCAAATACGG
>probe:Drosophila_2:1634226_at:604:427; Interrogation_Position=1494; Antisense; GAGTTTTCACTTTATGTACACCTAA
>probe:Drosophila_2:1634226_at:627:423; Interrogation_Position=960; Antisense; GAGACTTTTTCTCCCTGAATTCCGA
>probe:Drosophila_2:1634226_at:645:363; Interrogation_Position=976; Antisense; GAATTCCGAGCAAAAGCTGCCTGAG

Paste this into a BLAST search page for me
ACGAGATTAGCGCTCTAGTGGCCAAAGAAGCCGCCCGACTTCAGGAAGAGGGAAGAGCAGTCTCAGATTGCACAAGATTGCACAAAAGCGCTACCATGAGGCAAAAATGCCAAGCGCCGGCGGAAGACATATCTGGGTCTCAGGTGCTACCAGGTGCTACCTGATCGCGAGGAATAATGGATGCGATCGGCTCTGGCTTCAGGGACTCGGCGCAAGCACCAGATCGAAGGCCAACGAAGCCGAGCTGCAGGTCGGGCCACCCAAAGCAAATACGGGAGTTTTCACTTTATGTACACCTAAGAGACTTTTTCTCCCTGAATTCCGAGAATTCCGAGCAAAAGCTGCCTGAG

Full Affymetrix probeset data:

Annotations for 1634226_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720