FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634228_at:

>probe:Drosophila_2:1634228_at:538:401; Interrogation_Position=1015; Antisense; GACATCCTGCCTAATACCGTTAAAT
>probe:Drosophila_2:1634228_at:242:167; Interrogation_Position=1036; Antisense; AAATGCGCCATCATTGTCAACAGCC
>probe:Drosophila_2:1634228_at:533:417; Interrogation_Position=1113; Antisense; GAGCATAATTTTCCACGGCCATAAT
>probe:Drosophila_2:1634228_at:230:181; Interrogation_Position=1144; Antisense; AAAACAATTTCGTGTGCGCCACATT
>probe:Drosophila_2:1634228_at:377:373; Interrogation_Position=604; Antisense; GAAGAGCAGGCAAGGACCACCTCAC
>probe:Drosophila_2:1634228_at:160:347; Interrogation_Position=632; Antisense; GCATCCAAGGACAACTGCCAGTGTA
>probe:Drosophila_2:1634228_at:392:441; Interrogation_Position=696; Antisense; GATGGAGCTGCTTTCTTGGCTGAGC
>probe:Drosophila_2:1634228_at:212:419; Interrogation_Position=717; Antisense; GAGCTGCTCGCTGCACATGAAAAAG
>probe:Drosophila_2:1634228_at:280:55; Interrogation_Position=742; Antisense; ATGAAACTGCTCTCGGTGTTCGGTA
>probe:Drosophila_2:1634228_at:347:437; Interrogation_Position=804; Antisense; GAGGACCCAGCACAGGACACTCGAG
>probe:Drosophila_2:1634228_at:492:141; Interrogation_Position=855; Antisense; ACAGTTGGCCCAGACAGAGACATAC
>probe:Drosophila_2:1634228_at:437:101; Interrogation_Position=870; Antisense; AGAGACATACCTTGACACTCGCTTG
>probe:Drosophila_2:1634228_at:497:259; Interrogation_Position=885; Antisense; CACTCGCTTGCTCTTTGGTGAAGGA
>probe:Drosophila_2:1634228_at:159:369; Interrogation_Position=936; Antisense; GAATGTGTCCTCGTTGTCGGATGAC

Paste this into a BLAST search page for me
GACATCCTGCCTAATACCGTTAAATAAATGCGCCATCATTGTCAACAGCCGAGCATAATTTTCCACGGCCATAATAAAACAATTTCGTGTGCGCCACATTGAAGAGCAGGCAAGGACCACCTCACGCATCCAAGGACAACTGCCAGTGTAGATGGAGCTGCTTTCTTGGCTGAGCGAGCTGCTCGCTGCACATGAAAAAGATGAAACTGCTCTCGGTGTTCGGTAGAGGACCCAGCACAGGACACTCGAGACAGTTGGCCCAGACAGAGACATACAGAGACATACCTTGACACTCGCTTGCACTCGCTTGCTCTTTGGTGAAGGAGAATGTGTCCTCGTTGTCGGATGAC

Full Affymetrix probeset data:

Annotations for 1634228_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720