Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634229_at:

>probe:Drosophila_2:1634229_at:64:719; Interrogation_Position=1386; Antisense; TTCCAGCCTCGTGGATATTCAGTAC
>probe:Drosophila_2:1634229_at:122:241; Interrogation_Position=1440; Antisense; AATACGCGGCAGCACGGATGAAATT
>probe:Drosophila_2:1634229_at:144:87; Interrogation_Position=1467; Antisense; AGTGCCAGTCACTGTGTGCGTCTTC
>probe:Drosophila_2:1634229_at:683:621; Interrogation_Position=1483; Antisense; TGCGTCTTCGTTATGGTCGGGTATA
>probe:Drosophila_2:1634229_at:383:441; Interrogation_Position=1558; Antisense; GATGGGAGCTACTTCTGCCTTATAT
>probe:Drosophila_2:1634229_at:522:625; Interrogation_Position=1573; Antisense; TGCCTTATATCGCTCAGCAGCATTG
>probe:Drosophila_2:1634229_at:346:21; Interrogation_Position=1599; Antisense; ATTTGGCGATCTGGTGCCAGGCGAT
>probe:Drosophila_2:1634229_at:575:571; Interrogation_Position=1618; Antisense; GGCGATCGTGTGATAACTGCCGACA
>probe:Drosophila_2:1634229_at:463:705; Interrogation_Position=1658; Antisense; TTAGCTTCATTCTCTGCGCCATATA
>probe:Drosophila_2:1634229_at:159:579; Interrogation_Position=1698; Antisense; GGCCGTGATTGCCATGTGCTTCAAT
>probe:Drosophila_2:1634229_at:460:349; Interrogation_Position=1728; Antisense; GCAGGAGCAGGTCGTTCACAACATT
>probe:Drosophila_2:1634229_at:397:537; Interrogation_Position=1768; Antisense; GGATTCAAGGCCTGCTTTCGGTGCC
>probe:Drosophila_2:1634229_at:649:705; Interrogation_Position=1852; Antisense; TTACTCGCTGTTAGTGTAGGCTCTC
>probe:Drosophila_2:1634229_at:175:681; Interrogation_Position=1868; Antisense; TAGGCTCTCCTAGGCTAGCTTAAGA

Paste this into a BLAST search page for me
TTCCAGCCTCGTGGATATTCAGTACAATACGCGGCAGCACGGATGAAATTAGTGCCAGTCACTGTGTGCGTCTTCTGCGTCTTCGTTATGGTCGGGTATAGATGGGAGCTACTTCTGCCTTATATTGCCTTATATCGCTCAGCAGCATTGATTTGGCGATCTGGTGCCAGGCGATGGCGATCGTGTGATAACTGCCGACATTAGCTTCATTCTCTGCGCCATATAGGCCGTGATTGCCATGTGCTTCAATGCAGGAGCAGGTCGTTCACAACATTGGATTCAAGGCCTGCTTTCGGTGCCTTACTCGCTGTTAGTGTAGGCTCTCTAGGCTCTCCTAGGCTAGCTTAAGA

Full Affymetrix probeset data:

Annotations for 1634229_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime