Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634232_at:

>probe:Drosophila_2:1634232_at:714:695; Interrogation_Position=176; Antisense; TTTACCACCCAATGAATGACTGCGG
>probe:Drosophila_2:1634232_at:576:533; Interrogation_Position=210; Antisense; GGTGCTGATCAACACGCGGGAAATC
>probe:Drosophila_2:1634232_at:633:559; Interrogation_Position=228; Antisense; GGAAATCGCTTTGCCCGGTGACGAG
>probe:Drosophila_2:1634232_at:60:615; Interrogation_Position=257; Antisense; TGAAGAGGGTTTACTTCCACCACAC
>probe:Drosophila_2:1634232_at:638:43; Interrogation_Position=287; Antisense; ATCCTGGTGGCGCTTCGTGGACCCT
>probe:Drosophila_2:1634232_at:107:119; Interrogation_Position=320; Antisense; AGCTGCACGAGAAGGATCCCACGAT
>probe:Drosophila_2:1634232_at:725:487; Interrogation_Position=363; Antisense; GTACAACTCGATGCGCGGAAATCTG
>probe:Drosophila_2:1634232_at:650:123; Interrogation_Position=389; Antisense; AGCGCAGGCACACCATGCAAAGACT
>probe:Drosophila_2:1634232_at:702:615; Interrogation_Position=404; Antisense; TGCAAAGACTGCACTTGTTCGCCGA
>probe:Drosophila_2:1634232_at:103:303; Interrogation_Position=425; Antisense; CCGACGATCAGGTGCCCGAGGAAAT
>probe:Drosophila_2:1634232_at:687:559; Interrogation_Position=444; Antisense; GGAAATCCTGCAAAACGTCACGAAT
>probe:Drosophila_2:1634232_at:663:197; Interrogation_Position=457; Antisense; AACGTCACGAATCAAATCCGCACGC
>probe:Drosophila_2:1634232_at:265:301; Interrogation_Position=494; Antisense; CCCAGCGTCTGGATCATATCGACAA
>probe:Drosophila_2:1634232_at:265:551; Interrogation_Position=528; Antisense; GGAGAACTTCCCCAACATTATGGAT

Paste this into a BLAST search page for me
TTTACCACCCAATGAATGACTGCGGGGTGCTGATCAACACGCGGGAAATCGGAAATCGCTTTGCCCGGTGACGAGTGAAGAGGGTTTACTTCCACCACACATCCTGGTGGCGCTTCGTGGACCCTAGCTGCACGAGAAGGATCCCACGATGTACAACTCGATGCGCGGAAATCTGAGCGCAGGCACACCATGCAAAGACTTGCAAAGACTGCACTTGTTCGCCGACCGACGATCAGGTGCCCGAGGAAATGGAAATCCTGCAAAACGTCACGAATAACGTCACGAATCAAATCCGCACGCCCCAGCGTCTGGATCATATCGACAAGGAGAACTTCCCCAACATTATGGAT

Full Affymetrix probeset data:

Annotations for 1634232_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime