FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634235_at:

>probe:Drosophila_2:1634235_at:726:581; Interrogation_Position=1016; Antisense; TGGCCCCGGGCGAATCAAACGATGC
>probe:Drosophila_2:1634235_at:294:177; Interrogation_Position=1032; Antisense; AAACGATGCCCACGAGACACAATTA
>probe:Drosophila_2:1634235_at:725:571; Interrogation_Position=1071; Antisense; GGCTAATCCACATTTGGTCACCGAT
>probe:Drosophila_2:1634235_at:408:109; Interrogation_Position=590; Antisense; AGAAGCTGCAGCTCCGGGATCTTTA
>probe:Drosophila_2:1634235_at:182:5; Interrogation_Position=630; Antisense; ATTCGTTCCGAATCGCGGCAAGCGG
>probe:Drosophila_2:1634235_at:493:149; Interrogation_Position=656; Antisense; ACTTGACAGCCAGTGCCGGGAAATT
>probe:Drosophila_2:1634235_at:541:669; Interrogation_Position=730; Antisense; TACTGGCCGCTAAGAATGTCAACGC
>probe:Drosophila_2:1634235_at:724:539; Interrogation_Position=766; Antisense; GGTTACGATCAATCAGTCAGGCCAT
>probe:Drosophila_2:1634235_at:650:51; Interrogation_Position=806; Antisense; ATGCTGCTGCATCGTTGGCTTCTTG
>probe:Drosophila_2:1634235_at:210:575; Interrogation_Position=830; Antisense; GGCGACTGCCCGCTAATAGATTGCA
>probe:Drosophila_2:1634235_at:344:231; Interrogation_Position=867; Antisense; AATGTCAGCCGATCTGCGGCAGCAA
>probe:Drosophila_2:1634235_at:138:569; Interrogation_Position=884; Antisense; GGCAGCAATTGCTCTTGCCACATGT
>probe:Drosophila_2:1634235_at:227:153; Interrogation_Position=903; Antisense; ACATGTCCGCTTCATTGGCAATCCG
>probe:Drosophila_2:1634235_at:284:613; Interrogation_Position=968; Antisense; TGAAAACCTCATCCTGGCAGGCAGA

Paste this into a BLAST search page for me
TGGCCCCGGGCGAATCAAACGATGCAAACGATGCCCACGAGACACAATTAGGCTAATCCACATTTGGTCACCGATAGAAGCTGCAGCTCCGGGATCTTTAATTCGTTCCGAATCGCGGCAAGCGGACTTGACAGCCAGTGCCGGGAAATTTACTGGCCGCTAAGAATGTCAACGCGGTTACGATCAATCAGTCAGGCCATATGCTGCTGCATCGTTGGCTTCTTGGGCGACTGCCCGCTAATAGATTGCAAATGTCAGCCGATCTGCGGCAGCAAGGCAGCAATTGCTCTTGCCACATGTACATGTCCGCTTCATTGGCAATCCGTGAAAACCTCATCCTGGCAGGCAGA

Full Affymetrix probeset data:

Annotations for 1634235_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720