Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634236_at:

>probe:Drosophila_2:1634236_at:686:135; Interrogation_Position=1540; Antisense; ACGACAACCAGGGAGCCGCCGGTGA
>probe:Drosophila_2:1634236_at:363:211; Interrogation_Position=1657; Antisense; AAGAAGCCCATAATGCCGCCAGTGC
>probe:Drosophila_2:1634236_at:76:179; Interrogation_Position=1725; Antisense; AAACTCCAGGCTGCAGGTACAGGCG
>probe:Drosophila_2:1634236_at:469:565; Interrogation_Position=1750; Antisense; GGCACGGAGCACGAGTCGCAATCGA
>probe:Drosophila_2:1634236_at:296:111; Interrogation_Position=1816; Antisense; AGCAACGGTGCCTGGATAAAGACGC
>probe:Drosophila_2:1634236_at:467:663; Interrogation_Position=1832; Antisense; TAAAGACGCACTGGGCCTACATCGA
>probe:Drosophila_2:1634236_at:155:43; Interrogation_Position=1852; Antisense; ATCGATCCATCGACGTACTTCCAAT
>probe:Drosophila_2:1634236_at:133:669; Interrogation_Position=1867; Antisense; TACTTCCAATGGAGCGGCTACAAGG
>probe:Drosophila_2:1634236_at:723:137; Interrogation_Position=1892; Antisense; ACGAGGATAGCGTGCTGCTGCCCGC
>probe:Drosophila_2:1634236_at:254:635; Interrogation_Position=1928; Antisense; TCGCCCTCATCGGAGTGATTTTGAT
>probe:Drosophila_2:1634236_at:275:725; Interrogation_Position=1948; Antisense; TTGATCATCACGGTCTGCCTGGTGG
>probe:Drosophila_2:1634236_at:144:585; Interrogation_Position=1970; Antisense; TGGCACGCAACAAGCGCACCATTGT
>probe:Drosophila_2:1634236_at:201:483; Interrogation_Position=2027; Antisense; GTATACTGTGCATTTGGCTTGACCA
>probe:Drosophila_2:1634236_at:247:723; Interrogation_Position=2040; Antisense; TTGGCTTGACCAACGAACCGGAAGT

Paste this into a BLAST search page for me
ACGACAACCAGGGAGCCGCCGGTGAAAGAAGCCCATAATGCCGCCAGTGCAAACTCCAGGCTGCAGGTACAGGCGGGCACGGAGCACGAGTCGCAATCGAAGCAACGGTGCCTGGATAAAGACGCTAAAGACGCACTGGGCCTACATCGAATCGATCCATCGACGTACTTCCAATTACTTCCAATGGAGCGGCTACAAGGACGAGGATAGCGTGCTGCTGCCCGCTCGCCCTCATCGGAGTGATTTTGATTTGATCATCACGGTCTGCCTGGTGGTGGCACGCAACAAGCGCACCATTGTGTATACTGTGCATTTGGCTTGACCATTGGCTTGACCAACGAACCGGAAGT

Full Affymetrix probeset data:

Annotations for 1634236_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime