Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634237_at:

>probe:Drosophila_2:1634237_at:468:451; Interrogation_Position=1102; Antisense; GATCTCTGGACCTAATCGTTGGCAA
>probe:Drosophila_2:1634237_at:204:207; Interrogation_Position=1125; Antisense; AAGCTCGTGTCTACCTAGGCATAGG
>probe:Drosophila_2:1634237_at:643:569; Interrogation_Position=1142; Antisense; GGCATAGGGCCATAGTTGTTCTTAG
>probe:Drosophila_2:1634237_at:359:169; Interrogation_Position=1206; Antisense; AAAGTGGCACTCAATTGGCTTGGAA
>probe:Drosophila_2:1634237_at:628:663; Interrogation_Position=1254; Antisense; TAAAGCTCAAGTTCCGCGGCTATCA
>probe:Drosophila_2:1634237_at:540:271; Interrogation_Position=1277; Antisense; CATCGGTTTCGATCTTGCAGTGAGA
>probe:Drosophila_2:1634237_at:504:569; Interrogation_Position=1308; Antisense; GGCATATAGTTTCTCGATCTCATCG
>probe:Drosophila_2:1634237_at:613:451; Interrogation_Position=1323; Antisense; GATCTCATCGGCATACATCTTGGAC
>probe:Drosophila_2:1634237_at:64:37; Interrogation_Position=1339; Antisense; ATCTTGGACACAACGTTGCGCTTAA
>probe:Drosophila_2:1634237_at:11:511; Interrogation_Position=1420; Antisense; GTGAACTTCTGAACCTTTTGGGCAT
>probe:Drosophila_2:1634237_at:603:393; Interrogation_Position=1447; Antisense; GAAATGGACTGCTTGTTGGCCCGCT
>probe:Drosophila_2:1634237_at:336:657; Interrogation_Position=1472; Antisense; TAATGGCATCCTCGATGGACTTCCA
>probe:Drosophila_2:1634237_at:534:23; Interrogation_Position=1525; Antisense; ATATCCGATACGGTCTTGTGCTCCA
>probe:Drosophila_2:1634237_at:414:121; Interrogation_Position=1555; Antisense; AGCGATTTCACCCACACGGAGGACT

Paste this into a BLAST search page for me
GATCTCTGGACCTAATCGTTGGCAAAAGCTCGTGTCTACCTAGGCATAGGGGCATAGGGCCATAGTTGTTCTTAGAAAGTGGCACTCAATTGGCTTGGAATAAAGCTCAAGTTCCGCGGCTATCACATCGGTTTCGATCTTGCAGTGAGAGGCATATAGTTTCTCGATCTCATCGGATCTCATCGGCATACATCTTGGACATCTTGGACACAACGTTGCGCTTAAGTGAACTTCTGAACCTTTTGGGCATGAAATGGACTGCTTGTTGGCCCGCTTAATGGCATCCTCGATGGACTTCCAATATCCGATACGGTCTTGTGCTCCAAGCGATTTCACCCACACGGAGGACT

Full Affymetrix probeset data:

Annotations for 1634237_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime