Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634238_a_at:

>probe:Drosophila_2:1634238_a_at:107:367; Interrogation_Position=532; Antisense; GAATCTAGTGGCCTTTGTGCTCTTC
>probe:Drosophila_2:1634238_a_at:61:79; Interrogation_Position=600; Antisense; AGGATCGCAACTACTGGCACCCGAA
>probe:Drosophila_2:1634238_a_at:510:567; Interrogation_Position=615; Antisense; GGCACCCGAATATGCATCGTTTGGA
>probe:Drosophila_2:1634238_a_at:150:43; Interrogation_Position=630; Antisense; ATCGTTTGGATCTCGTGATGGCTTC
>probe:Drosophila_2:1634238_a_at:393:463; Interrogation_Position=661; Antisense; GATTGCCTTGGTTACCTCGCTGGTC
>probe:Drosophila_2:1634238_a_at:399:591; Interrogation_Position=681; Antisense; TGGTCTTCTTGCTGGACATACTCAT
>probe:Drosophila_2:1634238_a_at:216:151; Interrogation_Position=696; Antisense; ACATACTCATCACCCTGCGTTTAGG
>probe:Drosophila_2:1634238_a_at:400:281; Interrogation_Position=710; Antisense; CTGCGTTTAGGTGTCCACGGTGATC
>probe:Drosophila_2:1634238_a_at:704:399; Interrogation_Position=741; Antisense; GACATGGTCGATCCCGTGAAGTTTG
>probe:Drosophila_2:1634238_a_at:228:459; Interrogation_Position=776; Antisense; GATATACATTCGATTCTCGCCTAGC
>probe:Drosophila_2:1634238_a_at:324:643; Interrogation_Position=790; Antisense; TCTCGCCTAGCGTGGACTGTAATAT
>probe:Drosophila_2:1634238_a_at:312:335; Interrogation_Position=826; Antisense; GCTTAGAAGTAAGAGCCCCGTTCAC
>probe:Drosophila_2:1634238_a_at:393:673; Interrogation_Position=852; Antisense; TACCCGTCTCCCAGCTAATTGTAAT
>probe:Drosophila_2:1634238_a_at:675:709; Interrogation_Position=940; Antisense; TTAAAGTTCTTAATCGGCTGCCCTG

Paste this into a BLAST search page for me
GAATCTAGTGGCCTTTGTGCTCTTCAGGATCGCAACTACTGGCACCCGAAGGCACCCGAATATGCATCGTTTGGAATCGTTTGGATCTCGTGATGGCTTCGATTGCCTTGGTTACCTCGCTGGTCTGGTCTTCTTGCTGGACATACTCATACATACTCATCACCCTGCGTTTAGGCTGCGTTTAGGTGTCCACGGTGATCGACATGGTCGATCCCGTGAAGTTTGGATATACATTCGATTCTCGCCTAGCTCTCGCCTAGCGTGGACTGTAATATGCTTAGAAGTAAGAGCCCCGTTCACTACCCGTCTCCCAGCTAATTGTAATTTAAAGTTCTTAATCGGCTGCCCTG

Full Affymetrix probeset data:

Annotations for 1634238_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime