Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634239_at:

>probe:Drosophila_2:1634239_at:216:713; Interrogation_Position=1749; Antisense; TTCTATCTGACCTTCACCCGGATCG
>probe:Drosophila_2:1634239_at:331:37; Interrogation_Position=1896; Antisense; ATCTTCCACATGTTCATGGAGAGCC
>probe:Drosophila_2:1634239_at:193:67; Interrogation_Position=1911; Antisense; ATGGAGAGCCTCAACGCCGGCATTA
>probe:Drosophila_2:1634239_at:149:355; Interrogation_Position=1939; Antisense; GCACCAACACCTACTTCAGTGATTA
>probe:Drosophila_2:1634239_at:503:267; Interrogation_Position=1955; Antisense; CAGTGATTACCAAGTTATGCTTCGT
>probe:Drosophila_2:1634239_at:217:683; Interrogation_Position=1970; Antisense; TATGCTTCGTTTCTGGTGCGATTTT
>probe:Drosophila_2:1634239_at:490:499; Interrogation_Position=1985; Antisense; GTGCGATTTTGGCTTTACCGTGCTC
>probe:Drosophila_2:1634239_at:636:633; Interrogation_Position=2011; Antisense; TCGCCTTCGCTGTGTACATTCTGAT
>probe:Drosophila_2:1634239_at:360:515; Interrogation_Position=2022; Antisense; GTGTACATTCTGATCGAGGCGCCGT
>probe:Drosophila_2:1634239_at:697:41; Interrogation_Position=2034; Antisense; ATCGAGGCGCCGTTTGGAAATTTGG
>probe:Drosophila_2:1634239_at:374:559; Interrogation_Position=2049; Antisense; GGAAATTTGGAAGGCCTCCTGCTTC
>probe:Drosophila_2:1634239_at:664:509; Interrogation_Position=2143; Antisense; GTGCATCTGCGCCAACACTGGAAAA
>probe:Drosophila_2:1634239_at:566:211; Interrogation_Position=2166; Antisense; AATAAAACGCCTCTTCCGGCATAAG
>probe:Drosophila_2:1634239_at:332:627; Interrogation_Position=2180; Antisense; TCCGGCATAAGGATCTCGAAACTAT

Paste this into a BLAST search page for me
TTCTATCTGACCTTCACCCGGATCGATCTTCCACATGTTCATGGAGAGCCATGGAGAGCCTCAACGCCGGCATTAGCACCAACACCTACTTCAGTGATTACAGTGATTACCAAGTTATGCTTCGTTATGCTTCGTTTCTGGTGCGATTTTGTGCGATTTTGGCTTTACCGTGCTCTCGCCTTCGCTGTGTACATTCTGATGTGTACATTCTGATCGAGGCGCCGTATCGAGGCGCCGTTTGGAAATTTGGGGAAATTTGGAAGGCCTCCTGCTTCGTGCATCTGCGCCAACACTGGAAAAAATAAAACGCCTCTTCCGGCATAAGTCCGGCATAAGGATCTCGAAACTAT

Full Affymetrix probeset data:

Annotations for 1634239_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime