FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634240_at:

>probe:Drosophila_2:1634240_at:672:191; Interrogation_Position=247; Antisense; AACGGTTCGAGGCACCAACTGTATT
>probe:Drosophila_2:1634240_at:285:179; Interrogation_Position=286; Antisense; AAACATCCTTAGTTCATGCACCAGC
>probe:Drosophila_2:1634240_at:10:547; Interrogation_Position=316; Antisense; GGATGCTATTGATGCCTGTGGCACT
>probe:Drosophila_2:1634240_at:146:581; Interrogation_Position=357; Antisense; TGGCCAAGATTGTGGACTCCGTTAA
>probe:Drosophila_2:1634240_at:240:273; Interrogation_Position=419; Antisense; CATTCGAAACTTTGTGCCACGGATA
>probe:Drosophila_2:1634240_at:694:517; Interrogation_Position=449; Antisense; GTGGGCTCGTCCATCAAAAACTCGG
>probe:Drosophila_2:1634240_at:307:179; Interrogation_Position=466; Antisense; AAACTCGGCCAAATGCTTCTGGAAA
>probe:Drosophila_2:1634240_at:174:227; Interrogation_Position=497; Antisense; AAGGCATCCATGAGGCTGACCCGAA
>probe:Drosophila_2:1634240_at:702:161; Interrogation_Position=551; Antisense; AAATTGCCAGCCGATACCAGTTCCT
>probe:Drosophila_2:1634240_at:180:719; Interrogation_Position=571; Antisense; TTCCTGCTTCGTAAATGCCACCAAT
>probe:Drosophila_2:1634240_at:357:709; Interrogation_Position=600; Antisense; TTACAGCGTCCTTTAACTCTTTTCT
>probe:Drosophila_2:1634240_at:457:661; Interrogation_Position=613; Antisense; TAACTCTTTTCTGCCCAACATTGAT
>probe:Drosophila_2:1634240_at:120:607; Interrogation_Position=634; Antisense; TGATGTCTGCATCGAGTCTATGTAA
>probe:Drosophila_2:1634240_at:640:413; Interrogation_Position=70; Antisense; GACCACGCGGGCCAATGCAATAGAA

Paste this into a BLAST search page for me
AACGGTTCGAGGCACCAACTGTATTAAACATCCTTAGTTCATGCACCAGCGGATGCTATTGATGCCTGTGGCACTTGGCCAAGATTGTGGACTCCGTTAACATTCGAAACTTTGTGCCACGGATAGTGGGCTCGTCCATCAAAAACTCGGAAACTCGGCCAAATGCTTCTGGAAAAAGGCATCCATGAGGCTGACCCGAAAAATTGCCAGCCGATACCAGTTCCTTTCCTGCTTCGTAAATGCCACCAATTTACAGCGTCCTTTAACTCTTTTCTTAACTCTTTTCTGCCCAACATTGATTGATGTCTGCATCGAGTCTATGTAAGACCACGCGGGCCAATGCAATAGAA

Full Affymetrix probeset data:

Annotations for 1634240_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720