FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634241_at:

>probe:Drosophila_2:1634241_at:359:451; Interrogation_Position=1154; Antisense; GATCTGCCTGCGGAGCTTTACTACC
>probe:Drosophila_2:1634241_at:18:135; Interrogation_Position=1182; Antisense; ACGCCCGCGTCACAGAGATTTACGA
>probe:Drosophila_2:1634241_at:515:209; Interrogation_Position=1225; Antisense; AAGAATTGTGATCGCCAACGCAGTG
>probe:Drosophila_2:1634241_at:141:541; Interrogation_Position=1285; Antisense; GGTTTTTCTTTATTACTGCTGCCAA
>probe:Drosophila_2:1634241_at:281:363; Interrogation_Position=1318; Antisense; GAATTCTTGCTTTTACACTTGTTGT
>probe:Drosophila_2:1634241_at:90:215; Interrogation_Position=815; Antisense; AAGATCGCCATGCAGTCCTTGGACT
>probe:Drosophila_2:1634241_at:189:521; Interrogation_Position=840; Antisense; GTGGCAGGATCGGTATAGCCGCCCA
>probe:Drosophila_2:1634241_at:435:539; Interrogation_Position=872; Antisense; GGTATCGCACAAGCTGCCCTGGAAC
>probe:Drosophila_2:1634241_at:324:321; Interrogation_Position=887; Antisense; GCCCTGGAACTAGCCGTGGATTATT
>probe:Drosophila_2:1634241_at:47:99; Interrogation_Position=918; Antisense; AGAGGGTGGCCTTCGGAAAGCATCT
>probe:Drosophila_2:1634241_at:216:393; Interrogation_Position=933; Antisense; GAAAGCATCTGGCACGGTTGCAGCT
>probe:Drosophila_2:1634241_at:41:541; Interrogation_Position=948; Antisense; GGTTGCAGCTCATCCAGCAGAAGCT
>probe:Drosophila_2:1634241_at:400:69; Interrogation_Position=980; Antisense; ATGGCCACGCGGGTGGAGATCTCAA
>probe:Drosophila_2:1634241_at:344:453; Interrogation_Position=997; Antisense; GATCTCAAGGCTGCTAACGTGGCGT

Paste this into a BLAST search page for me
GATCTGCCTGCGGAGCTTTACTACCACGCCCGCGTCACAGAGATTTACGAAAGAATTGTGATCGCCAACGCAGTGGGTTTTTCTTTATTACTGCTGCCAAGAATTCTTGCTTTTACACTTGTTGTAAGATCGCCATGCAGTCCTTGGACTGTGGCAGGATCGGTATAGCCGCCCAGGTATCGCACAAGCTGCCCTGGAACGCCCTGGAACTAGCCGTGGATTATTAGAGGGTGGCCTTCGGAAAGCATCTGAAAGCATCTGGCACGGTTGCAGCTGGTTGCAGCTCATCCAGCAGAAGCTATGGCCACGCGGGTGGAGATCTCAAGATCTCAAGGCTGCTAACGTGGCGT

Full Affymetrix probeset data:

Annotations for 1634241_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720