Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634244_s_at:

>probe:Drosophila_2:1634244_s_at:339:631; Interrogation_Position=127; Antisense; TCCGTTTCTGAATCCGTGAAGCCTA
>probe:Drosophila_2:1634244_s_at:288:25; Interrogation_Position=158; Antisense; ATATGTGCGGTTATGGATGCGGTCC
>probe:Drosophila_2:1634244_s_at:374:547; Interrogation_Position=172; Antisense; GGATGCGGTCCCTATGGCTATGGAC
>probe:Drosophila_2:1634244_s_at:721:339; Interrogation_Position=252; Antisense; GCTAGGACCCTATTCCTGCTGTGGA
>probe:Drosophila_2:1634244_s_at:585:593; Interrogation_Position=271; Antisense; TGTGGACCCAGTGGATGCGGACCAA
>probe:Drosophila_2:1634244_s_at:151:563; Interrogation_Position=28; Antisense; GGAATTTTTATCTGGAGCTCTCTAG
>probe:Drosophila_2:1634244_s_at:17:513; Interrogation_Position=306; Antisense; GTGTTGGCCGTATGGCTTGTACACC
>probe:Drosophila_2:1634244_s_at:136:273; Interrogation_Position=321; Antisense; CTTGTACACCTGCTAGGCTTCAGAA
>probe:Drosophila_2:1634244_s_at:289:517; Interrogation_Position=359; Antisense; GTGTGAGCCATTCCCCAAGAAATTT
>probe:Drosophila_2:1634244_s_at:164:419; Interrogation_Position=42; Antisense; GAGCTCTCTAGTCAGGCCAAAACAG
>probe:Drosophila_2:1634244_s_at:57:683; Interrogation_Position=431; Antisense; TATGTTCCCGTTGTTTTCATTAAAG
>probe:Drosophila_2:1634244_s_at:408:97; Interrogation_Position=481; Antisense; AGATGGAAATCGCAGCCCCTAACAA
>probe:Drosophila_2:1634244_s_at:47:157; Interrogation_Position=502; Antisense; ACAAATTTGTCCACCAATCCTTTCG
>probe:Drosophila_2:1634244_s_at:165:325; Interrogation_Position=526; Antisense; GCGAATCCGCTTAAGCCTTTTACAT

Paste this into a BLAST search page for me
TCCGTTTCTGAATCCGTGAAGCCTAATATGTGCGGTTATGGATGCGGTCCGGATGCGGTCCCTATGGCTATGGACGCTAGGACCCTATTCCTGCTGTGGATGTGGACCCAGTGGATGCGGACCAAGGAATTTTTATCTGGAGCTCTCTAGGTGTTGGCCGTATGGCTTGTACACCCTTGTACACCTGCTAGGCTTCAGAAGTGTGAGCCATTCCCCAAGAAATTTGAGCTCTCTAGTCAGGCCAAAACAGTATGTTCCCGTTGTTTTCATTAAAGAGATGGAAATCGCAGCCCCTAACAAACAAATTTGTCCACCAATCCTTTCGGCGAATCCGCTTAAGCCTTTTACAT

Full Affymetrix probeset data:

Annotations for 1634244_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime