FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634246_at:

>probe:Drosophila_2:1634246_at:110:233; Interrogation_Position=4171; Antisense; AATGCGAAATGCCAACCTTACCGTA
>probe:Drosophila_2:1634246_at:139:491; Interrogation_Position=4230; Antisense; GTAACTCAATAACTCCTAGAGAGCT
>probe:Drosophila_2:1634246_at:441:425; Interrogation_Position=4248; Antisense; GAGAGCTCAAATGGCCAATGGGCAG
>probe:Drosophila_2:1634246_at:470:559; Interrogation_Position=4277; Antisense; GGAAATCTATCCTAACCAACGAAAT
>probe:Drosophila_2:1634246_at:535:29; Interrogation_Position=4337; Antisense; ATAAGCTTTAAGGTGGCTAGCTCAA
>probe:Drosophila_2:1634246_at:228:533; Interrogation_Position=4348; Antisense; GGTGGCTAGCTCAATTCAATTACTT
>probe:Drosophila_2:1634246_at:481:651; Interrogation_Position=4363; Antisense; TCAATTACTTTGTTTACTCCTTTCG
>probe:Drosophila_2:1634246_at:562:143; Interrogation_Position=4378; Antisense; ACTCCTTTCGTTAATGAGTGTTTGG
>probe:Drosophila_2:1634246_at:73:659; Interrogation_Position=4415; Antisense; TAAGCCGAATTACTTACTTAAGCGA
>probe:Drosophila_2:1634246_at:232:187; Interrogation_Position=4441; Antisense; AACAAAACCTTTGTGATCCAACAAG
>probe:Drosophila_2:1634246_at:114:607; Interrogation_Position=4454; Antisense; TGATCCAACAAGTTTCTTCTCTTCC
>probe:Drosophila_2:1634246_at:312:217; Interrogation_Position=4463; Antisense; AAGTTTCTTCTCTTCCATGAAGCAA
>probe:Drosophila_2:1634246_at:149:7; Interrogation_Position=4539; Antisense; ATTGACTTAATTAGCTGAGACGTTC
>probe:Drosophila_2:1634246_at:273:409; Interrogation_Position=4557; Antisense; GACGTTCAATAATTTCGCCTGGCAT

Paste this into a BLAST search page for me
AATGCGAAATGCCAACCTTACCGTAGTAACTCAATAACTCCTAGAGAGCTGAGAGCTCAAATGGCCAATGGGCAGGGAAATCTATCCTAACCAACGAAATATAAGCTTTAAGGTGGCTAGCTCAAGGTGGCTAGCTCAATTCAATTACTTTCAATTACTTTGTTTACTCCTTTCGACTCCTTTCGTTAATGAGTGTTTGGTAAGCCGAATTACTTACTTAAGCGAAACAAAACCTTTGTGATCCAACAAGTGATCCAACAAGTTTCTTCTCTTCCAAGTTTCTTCTCTTCCATGAAGCAAATTGACTTAATTAGCTGAGACGTTCGACGTTCAATAATTTCGCCTGGCAT

Full Affymetrix probeset data:

Annotations for 1634246_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720