Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634249_s_at:

>probe:Drosophila_2:1634249_s_at:525:85; Interrogation_Position=114; Antisense; AGTCCGATGGCCAGTTTTGCCGAGT
>probe:Drosophila_2:1634249_s_at:79:625; Interrogation_Position=131; Antisense; TGCCGAGTCGGTGCTGAATGTCATC
>probe:Drosophila_2:1634249_s_at:418:441; Interrogation_Position=156; Antisense; GATGGACCCATAACTTGGTTCCGTG
>probe:Drosophila_2:1634249_s_at:242:115; Interrogation_Position=208; Antisense; AGCAGAATTGGTACCACCAGCGCTT
>probe:Drosophila_2:1634249_s_at:631:449; Interrogation_Position=248; Antisense; GATCGACCAGTGCTACACGGACGAT
>probe:Drosophila_2:1634249_s_at:398:479; Interrogation_Position=283; Antisense; GTTTCGAGGCCGATCAGCAGTTCCG
>probe:Drosophila_2:1634249_s_at:656:317; Interrogation_Position=307; Antisense; GCCGGGATCGCATGGTCGACAACGA
>probe:Drosophila_2:1634249_s_at:595:427; Interrogation_Position=330; Antisense; GAGATTGTCAACATTCTGCGCCAGC
>probe:Drosophila_2:1634249_s_at:666:437; Interrogation_Position=378; Antisense; GAGGCACCCGATCACATGGTCAAGT
>probe:Drosophila_2:1634249_s_at:415:153; Interrogation_Position=391; Antisense; ACATGGTCAAGTGCAGGCCGCTGAT
>probe:Drosophila_2:1634249_s_at:559:369; Interrogation_Position=428; Antisense; GAAGGCCACCGAGAACTGGTTCATC
>probe:Drosophila_2:1634249_s_at:669:147; Interrogation_Position=463; Antisense; ACTTGGGAGGCTACGCCAATGCCAA
>probe:Drosophila_2:1634249_s_at:289:209; Interrogation_Position=507; Antisense; AAGCATCGTCTGATCTGGGAGCGTC
>probe:Drosophila_2:1634249_s_at:188:255; Interrogation_Position=569; Antisense; CGCCCATTAAACTCCGCTTTTATGA

Paste this into a BLAST search page for me
AGTCCGATGGCCAGTTTTGCCGAGTTGCCGAGTCGGTGCTGAATGTCATCGATGGACCCATAACTTGGTTCCGTGAGCAGAATTGGTACCACCAGCGCTTGATCGACCAGTGCTACACGGACGATGTTTCGAGGCCGATCAGCAGTTCCGGCCGGGATCGCATGGTCGACAACGAGAGATTGTCAACATTCTGCGCCAGCGAGGCACCCGATCACATGGTCAAGTACATGGTCAAGTGCAGGCCGCTGATGAAGGCCACCGAGAACTGGTTCATCACTTGGGAGGCTACGCCAATGCCAAAAGCATCGTCTGATCTGGGAGCGTCCGCCCATTAAACTCCGCTTTTATGA

Full Affymetrix probeset data:

Annotations for 1634249_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime