Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634250_at:

>probe:Drosophila_2:1634250_at:117:115; Interrogation_Position=1232; Antisense; AGCAGTTGCAGTTGCCTAGCACCAA
>probe:Drosophila_2:1634250_at:317:271; Interrogation_Position=1294; Antisense; CATCTGGTCCTGCTATTTGTGGTGG
>probe:Drosophila_2:1634250_at:391:333; Interrogation_Position=1336; Antisense; GCTGGTGCTCCACCGGCAAAAACAA
>probe:Drosophila_2:1634250_at:226:129; Interrogation_Position=1369; Antisense; ACCACCATCCAACCATTTGTTTTTG
>probe:Drosophila_2:1634250_at:511:367; Interrogation_Position=1393; Antisense; GAATGTCATTATTTACCAACGTGTC
>probe:Drosophila_2:1634250_at:707:253; Interrogation_Position=1409; Antisense; CAACGTGTCATCCTTGGTTCGAGAA
>probe:Drosophila_2:1634250_at:127:423; Interrogation_Position=1429; Antisense; GAGAATACTCTTTTGTACTGACTGA
>probe:Drosophila_2:1634250_at:425:723; Interrogation_Position=1479; Antisense; TTGTCAATCTAATGCCACGGACCGC
>probe:Drosophila_2:1634250_at:353:49; Interrogation_Position=1511; Antisense; ATCCACTTGTTAATCGCTCGCGGTT
>probe:Drosophila_2:1634250_at:74:337; Interrogation_Position=1526; Antisense; GCTCGCGGTTTCCTTAAATGTTGAT
>probe:Drosophila_2:1634250_at:593:467; Interrogation_Position=1545; Antisense; GTTGATCGCCATTTGATTGTTTTAC
>probe:Drosophila_2:1634250_at:415:699; Interrogation_Position=1564; Antisense; TTTTACGAATGAACCGACACCCTCA
>probe:Drosophila_2:1634250_at:336:399; Interrogation_Position=1579; Antisense; GACACCCTCATGTATTTTGTACAGA
>probe:Drosophila_2:1634250_at:316:381; Interrogation_Position=1602; Antisense; GAACCTAACAACTTCCCCGATAGAG

Paste this into a BLAST search page for me
AGCAGTTGCAGTTGCCTAGCACCAACATCTGGTCCTGCTATTTGTGGTGGGCTGGTGCTCCACCGGCAAAAACAAACCACCATCCAACCATTTGTTTTTGGAATGTCATTATTTACCAACGTGTCCAACGTGTCATCCTTGGTTCGAGAAGAGAATACTCTTTTGTACTGACTGATTGTCAATCTAATGCCACGGACCGCATCCACTTGTTAATCGCTCGCGGTTGCTCGCGGTTTCCTTAAATGTTGATGTTGATCGCCATTTGATTGTTTTACTTTTACGAATGAACCGACACCCTCAGACACCCTCATGTATTTTGTACAGAGAACCTAACAACTTCCCCGATAGAG

Full Affymetrix probeset data:

Annotations for 1634250_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime