Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634251_at:

>probe:Drosophila_2:1634251_at:449:533; Interrogation_Position=113; Antisense; GGTGCTAAGAAAGGAGCTGCCGCTC
>probe:Drosophila_2:1634251_at:486:409; Interrogation_Position=154; Antisense; GACCGCCGATCCTGTGACTTCCGAA
>probe:Drosophila_2:1634251_at:430:449; Interrogation_Position=161; Antisense; GATCCTGTGACTTCCGAATCGAACA
>probe:Drosophila_2:1634251_at:394:511; Interrogation_Position=167; Antisense; GTGACTTCCGAATCGAACAACGCAG
>probe:Drosophila_2:1634251_at:358:235; Interrogation_Position=177; Antisense; AATCGAACAACGCAGCGGAACCAGC
>probe:Drosophila_2:1634251_at:577:349; Interrogation_Position=188; Antisense; GCAGCGGAACCAGCCGCCAAGGAAG
>probe:Drosophila_2:1634251_at:97:327; Interrogation_Position=23; Antisense; GCGAGCAACATCGATTTTGGCTGAT
>probe:Drosophila_2:1634251_at:407:437; Interrogation_Position=286; Antisense; GAGGAATTCAATGTTTCCGTAGAAC
>probe:Drosophila_2:1634251_at:477:717; Interrogation_Position=300; Antisense; TTCCGTAGAACAATAAACCAATGGT
>probe:Drosophila_2:1634251_at:682:689; Interrogation_Position=38; Antisense; TTTGGCTGATGAAAAAATCGCTGTG
>probe:Drosophila_2:1634251_at:263:237; Interrogation_Position=53; Antisense; AATCGCTGTGATTTTTTCCAAATTT
>probe:Drosophila_2:1634251_at:211:513; Interrogation_Position=60; Antisense; GTGATTTTTTCCAAATTTCTGTGAA
>probe:Drosophila_2:1634251_at:259:245; Interrogation_Position=73; Antisense; AATTTCTGTGAAAATGCCGGCAAAA
>probe:Drosophila_2:1634251_at:362:225; Interrogation_Position=98; Antisense; AAGGAATCAAACAAGGGTGCTAAGA

Paste this into a BLAST search page for me
GGTGCTAAGAAAGGAGCTGCCGCTCGACCGCCGATCCTGTGACTTCCGAAGATCCTGTGACTTCCGAATCGAACAGTGACTTCCGAATCGAACAACGCAGAATCGAACAACGCAGCGGAACCAGCGCAGCGGAACCAGCCGCCAAGGAAGGCGAGCAACATCGATTTTGGCTGATGAGGAATTCAATGTTTCCGTAGAACTTCCGTAGAACAATAAACCAATGGTTTTGGCTGATGAAAAAATCGCTGTGAATCGCTGTGATTTTTTCCAAATTTGTGATTTTTTCCAAATTTCTGTGAAAATTTCTGTGAAAATGCCGGCAAAAAAGGAATCAAACAAGGGTGCTAAGA

Full Affymetrix probeset data:

Annotations for 1634251_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime