FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634253_at:

>probe:Drosophila_2:1634253_at:353:367; Interrogation_Position=1251; Antisense; GAATCTGTAAAACGCCTTCTCAACG
>probe:Drosophila_2:1634253_at:164:713; Interrogation_Position=1267; Antisense; TTCTCAACGCTTTGACTTTGGCATT
>probe:Drosophila_2:1634253_at:542:59; Interrogation_Position=1361; Antisense; ATGTAGCCGTGGAACAGGTGTCCAT
>probe:Drosophila_2:1634253_at:434:81; Interrogation_Position=1376; Antisense; AGGTGTCCATAGTTCAACCGCTTTC
>probe:Drosophila_2:1634253_at:139:81; Interrogation_Position=1417; Antisense; AGGTGCTGCTGCTCCAGGCTAGCCA
>probe:Drosophila_2:1634253_at:493:571; Interrogation_Position=1433; Antisense; GGCTAGCCAGCCATATCGTTTTTGT
>probe:Drosophila_2:1634253_at:5:683; Interrogation_Position=1446; Antisense; TATCGTTTTTGTTTGGTGCTTCTAA
>probe:Drosophila_2:1634253_at:537:177; Interrogation_Position=1518; Antisense; AAACAATGCTTATACTTCCTTCTAG
>probe:Drosophila_2:1634253_at:248:663; Interrogation_Position=1530; Antisense; TACTTCCTTCTAGTTTTACTTCTGA
>probe:Drosophila_2:1634253_at:256:107; Interrogation_Position=1558; Antisense; AGAAATTCTTCTGGCCTTTGTCATG
>probe:Drosophila_2:1634253_at:374:579; Interrogation_Position=1570; Antisense; GGCCTTTGTCATGCGTTTATCTAAT
>probe:Drosophila_2:1634253_at:321:55; Interrogation_Position=1611; Antisense; ATGAAATGGCGTGGCTTGCGGTTCT
>probe:Drosophila_2:1634253_at:339:721; Interrogation_Position=1626; Antisense; TTGCGGTTCTGATTCGAGTTGGGTT
>probe:Drosophila_2:1634253_at:237:467; Interrogation_Position=1643; Antisense; GTTGGGTTTGTATTAATCTCTTTCA

Paste this into a BLAST search page for me
GAATCTGTAAAACGCCTTCTCAACGTTCTCAACGCTTTGACTTTGGCATTATGTAGCCGTGGAACAGGTGTCCATAGGTGTCCATAGTTCAACCGCTTTCAGGTGCTGCTGCTCCAGGCTAGCCAGGCTAGCCAGCCATATCGTTTTTGTTATCGTTTTTGTTTGGTGCTTCTAAAAACAATGCTTATACTTCCTTCTAGTACTTCCTTCTAGTTTTACTTCTGAAGAAATTCTTCTGGCCTTTGTCATGGGCCTTTGTCATGCGTTTATCTAATATGAAATGGCGTGGCTTGCGGTTCTTTGCGGTTCTGATTCGAGTTGGGTTGTTGGGTTTGTATTAATCTCTTTCA

Full Affymetrix probeset data:

Annotations for 1634253_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720