FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634254_at:

>probe:Drosophila_2:1634254_at:622:593; Interrogation_Position=131; Antisense; TGGGCAGCACTCAGGAGCATACGGT
>probe:Drosophila_2:1634254_at:327:613; Interrogation_Position=155; Antisense; TGAAGGGTCACTACGGCCAGTCCTC
>probe:Drosophila_2:1634254_at:107:63; Interrogation_Position=227; Antisense; ATGTCCAGCGGTCCAGCATCAGCAA
>probe:Drosophila_2:1634254_at:79:117; Interrogation_Position=241; Antisense; AGCATCAGCAATGACGCCGGACTGG
>probe:Drosophila_2:1634254_at:140:83; Interrogation_Position=368; Antisense; AGGGCGTCGCCTATGGCGGACACTA
>probe:Drosophila_2:1634254_at:519:567; Interrogation_Position=431; Antisense; GGCACTCGCTGGGACTGGGACACTC
>probe:Drosophila_2:1634254_at:433:525; Interrogation_Position=447; Antisense; GGGACACTCGCTGGGACTTGGTCAA
>probe:Drosophila_2:1634254_at:721:651; Interrogation_Position=468; Antisense; TCAATCGCTGGGACTGGGCGGATAC
>probe:Drosophila_2:1634254_at:286:439; Interrogation_Position=509; Antisense; GAGGCTATGGCTCCTATAGTGCCGC
>probe:Drosophila_2:1634254_at:503:39; Interrogation_Position=541; Antisense; ATCTCGCACGGATATCTGGCCCATG
>probe:Drosophila_2:1634254_at:378:95; Interrogation_Position=585; Antisense; AGTTGTGAAATACGCCGCTGCTCCA
>probe:Drosophila_2:1634254_at:551:297; Interrogation_Position=600; Antisense; CGCTGCTCCATCGTACGGTAGGTGA
>probe:Drosophila_2:1634254_at:658:533; Interrogation_Position=82; Antisense; GGTCCGGCGGCCTATTCGATTAGTG
>probe:Drosophila_2:1634254_at:503:687; Interrogation_Position=94; Antisense; TATTCGATTAGTGCGCCCAGCGTTG

Paste this into a BLAST search page for me
TGGGCAGCACTCAGGAGCATACGGTTGAAGGGTCACTACGGCCAGTCCTCATGTCCAGCGGTCCAGCATCAGCAAAGCATCAGCAATGACGCCGGACTGGAGGGCGTCGCCTATGGCGGACACTAGGCACTCGCTGGGACTGGGACACTCGGGACACTCGCTGGGACTTGGTCAATCAATCGCTGGGACTGGGCGGATACGAGGCTATGGCTCCTATAGTGCCGCATCTCGCACGGATATCTGGCCCATGAGTTGTGAAATACGCCGCTGCTCCACGCTGCTCCATCGTACGGTAGGTGAGGTCCGGCGGCCTATTCGATTAGTGTATTCGATTAGTGCGCCCAGCGTTG

Full Affymetrix probeset data:

Annotations for 1634254_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720