Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634255_at:

>probe:Drosophila_2:1634255_at:41:287; Interrogation_Position=230; Antisense; CTGGCCGACCTGCAATCTAGATGGA
>probe:Drosophila_2:1634255_at:694:547; Interrogation_Position=252; Antisense; GGATGGCGAAGCTGGCCAACCGACA
>probe:Drosophila_2:1634255_at:238:109; Interrogation_Position=333; Antisense; AGAAGCAGGACCAGCCTGTCGAGGA
>probe:Drosophila_2:1634255_at:216:525; Interrogation_Position=361; Antisense; GGGCAGCGAAGTCGACATCTACGAT
>probe:Drosophila_2:1634255_at:663:535; Interrogation_Position=403; Antisense; GGTCAACAATCGCATCTACATTCCG
>probe:Drosophila_2:1634255_at:258:551; Interrogation_Position=444; Antisense; GGAGAGCTCGCTATTTCAACATTAT
>probe:Drosophila_2:1634255_at:122:711; Interrogation_Position=458; Antisense; TTCAACATTATGATGCGCGCCTTTG
>probe:Drosophila_2:1634255_at:421:51; Interrogation_Position=470; Antisense; ATGCGCGCCTTTGTCATCAAACGGG
>probe:Drosophila_2:1634255_at:119:13; Interrogation_Position=524; Antisense; ATTCTCGACAAGATCATGGCAGCCC
>probe:Drosophila_2:1634255_at:411:135; Interrogation_Position=552; Antisense; ACGCAGAGGGACAAGCCGAGCTTCA
>probe:Drosophila_2:1634255_at:292:295; Interrogation_Position=568; Antisense; CGAGCTTCAGGCGTTTGTTGACAAA
>probe:Drosophila_2:1634255_at:638:559; Interrogation_Position=607; Antisense; GGAAATGTAGTCCTTACAGCCTCCT
>probe:Drosophila_2:1634255_at:74:545; Interrogation_Position=633; Antisense; GGATAAGCACCCAAACACATAGATA
>probe:Drosophila_2:1634255_at:337:29; Interrogation_Position=785; Antisense; ATACGAATGCCATCGTCTTCTGTGG

Paste this into a BLAST search page for me
CTGGCCGACCTGCAATCTAGATGGAGGATGGCGAAGCTGGCCAACCGACAAGAAGCAGGACCAGCCTGTCGAGGAGGGCAGCGAAGTCGACATCTACGATGGTCAACAATCGCATCTACATTCCGGGAGAGCTCGCTATTTCAACATTATTTCAACATTATGATGCGCGCCTTTGATGCGCGCCTTTGTCATCAAACGGGATTCTCGACAAGATCATGGCAGCCCACGCAGAGGGACAAGCCGAGCTTCACGAGCTTCAGGCGTTTGTTGACAAAGGAAATGTAGTCCTTACAGCCTCCTGGATAAGCACCCAAACACATAGATAATACGAATGCCATCGTCTTCTGTGG

Full Affymetrix probeset data:

Annotations for 1634255_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime