FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634257_at:

>probe:Drosophila_2:1634257_at:430:69; Interrogation_Position=1016; Antisense; ATGGCCACTCGCTGCAATTCGATAT
>probe:Drosophila_2:1634257_at:661:635; Interrogation_Position=1034; Antisense; TCGATATCCAAACTGCGCGATTTCC
>probe:Drosophila_2:1634257_at:529:321; Interrogation_Position=1078; Antisense; GCCCATGGGATATGCGGTGCCGCAA
>probe:Drosophila_2:1634257_at:676:191; Interrogation_Position=1115; Antisense; AACTATTTCCTGGAGGTCAGCGCCT
>probe:Drosophila_2:1634257_at:110:451; Interrogation_Position=1173; Antisense; GATCGGCCCACTTGGAGCATTGCGG
>probe:Drosophila_2:1634257_at:290:1; Interrogation_Position=1253; Antisense; AAGCCGGGTTCCTGGTTCTCAGGAT
>probe:Drosophila_2:1634257_at:579:129; Interrogation_Position=1299; Antisense; ACCATTCCCATAATCTATCCTAAGC
>probe:Drosophila_2:1634257_at:94:701; Interrogation_Position=1346; Antisense; TTTTTGGCTCAAACCGATTGCGGTC
>probe:Drosophila_2:1634257_at:556:425; Interrogation_Position=822; Antisense; GAGATGCCCACTTCGTCGATGTGAT
>probe:Drosophila_2:1634257_at:267:293; Interrogation_Position=838; Antisense; CGATGTGATCCATAGCAATCCCGGG
>probe:Drosophila_2:1634257_at:235:47; Interrogation_Position=879; Antisense; ATCCGGTGGGCGATGTGGACTTCTA
>probe:Drosophila_2:1634257_at:586:707; Interrogation_Position=924; Antisense; TTGCGGCGGGCTGTTTCTCGGTAAC
>probe:Drosophila_2:1634257_at:514:307; Interrogation_Position=955; Antisense; CCATGCCCGATCCTGGGAATATTTT
>probe:Drosophila_2:1634257_at:553:173; Interrogation_Position=984; Antisense; AAACCGTTTTCCCAGGCAATGAGCG

Paste this into a BLAST search page for me
ATGGCCACTCGCTGCAATTCGATATTCGATATCCAAACTGCGCGATTTCCGCCCATGGGATATGCGGTGCCGCAAAACTATTTCCTGGAGGTCAGCGCCTGATCGGCCCACTTGGAGCATTGCGGAAGCCGGGTTCCTGGTTCTCAGGATACCATTCCCATAATCTATCCTAAGCTTTTTGGCTCAAACCGATTGCGGTCGAGATGCCCACTTCGTCGATGTGATCGATGTGATCCATAGCAATCCCGGGATCCGGTGGGCGATGTGGACTTCTATTGCGGCGGGCTGTTTCTCGGTAACCCATGCCCGATCCTGGGAATATTTTAAACCGTTTTCCCAGGCAATGAGCG

Full Affymetrix probeset data:

Annotations for 1634257_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720