Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634258_at:

>probe:Drosophila_2:1634258_at:431:483; Interrogation_Position=1674; Antisense; GTATCTGGGCAGTAGCAACATCATT
>probe:Drosophila_2:1634258_at:608:265; Interrogation_Position=1692; Antisense; CATCATTGTGACTGCCAAGGACGGC
>probe:Drosophila_2:1634258_at:167:225; Interrogation_Position=1717; Antisense; AAGGACTGCAAGTTGTTCCTGCCCG
>probe:Drosophila_2:1634258_at:554:295; Interrogation_Position=1755; Antisense; CGAGATCGAGATGCAGGCCCTTGTG
>probe:Drosophila_2:1634258_at:386:347; Interrogation_Position=1878; Antisense; GCATCGATCCCTGCTGAAGAGCGAG
>probe:Drosophila_2:1634258_at:503:417; Interrogation_Position=1896; Antisense; GAGCGAGCACCCCTAGGAGTTATCA
>probe:Drosophila_2:1634258_at:536:339; Interrogation_Position=1933; Antisense; GCTAATTATTTATCTCGAACCACGG
>probe:Drosophila_2:1634258_at:63:551; Interrogation_Position=1960; Antisense; GGAGTCGATTTCACTTGGGAGTTTT
>probe:Drosophila_2:1634258_at:77:543; Interrogation_Position=1977; Antisense; GGAGTTTTTAACCAATCTACAGTCA
>probe:Drosophila_2:1634258_at:624:129; Interrogation_Position=2068; Antisense; ACCTAAAACTTTCCAGCTCTGTAAT
>probe:Drosophila_2:1634258_at:221:227; Interrogation_Position=2167; Antisense; AAGGCTCAAGACCATTTTGCCCAAA
>probe:Drosophila_2:1634258_at:115:719; Interrogation_Position=2183; Antisense; TTGCCCAAAGAAATCGACCCGACCA
>probe:Drosophila_2:1634258_at:687:409; Interrogation_Position=2198; Antisense; GACCCGACCACTCGAAAGTAGATTT
>probe:Drosophila_2:1634258_at:699:205; Interrogation_Position=2224; Antisense; AAGCGACTTGTCTGAGTTCTGTAAA

Paste this into a BLAST search page for me
GTATCTGGGCAGTAGCAACATCATTCATCATTGTGACTGCCAAGGACGGCAAGGACTGCAAGTTGTTCCTGCCCGCGAGATCGAGATGCAGGCCCTTGTGGCATCGATCCCTGCTGAAGAGCGAGGAGCGAGCACCCCTAGGAGTTATCAGCTAATTATTTATCTCGAACCACGGGGAGTCGATTTCACTTGGGAGTTTTGGAGTTTTTAACCAATCTACAGTCAACCTAAAACTTTCCAGCTCTGTAATAAGGCTCAAGACCATTTTGCCCAAATTGCCCAAAGAAATCGACCCGACCAGACCCGACCACTCGAAAGTAGATTTAAGCGACTTGTCTGAGTTCTGTAAA

Full Affymetrix probeset data:

Annotations for 1634258_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime